Frecuencia y susceptibilidad a penicilina y meticilina de aislamientos ambientales de Staphylococcus aureus en un hospital de Cuenca

Carlos Andrade T1; Paola Orellana B1

Correspondence: Autor de Correspondencia: Andrade T Carlos. E-mail: E-mail:
Conflicto de Intereses* Los autores declaran no presentar conflictos de intereses.
Contribución de los Autores* ATC y OBP: concepción y diseño del estudio, análisis e interpretación de datos, análisis estadístico, revisión crítica del artículo. Elaboración del manuscrito y aprobación de la versión final a ser publicada.


Resumen

Staphylococcus aureus es un patógeno asociado con infecciones intrahospitalarias comúnmente hallado en las fosas nasales y las manos del personal de salud; así como, en superficies ambientales, las cuales se convierten en potenciales reservorios y vehículos de transmisión de infecciones. En este estudio se analizó la frecuencia y la susceptibilidad a penicilina y meticilina de aislamientos ambientales de S. aureus en un hospital de Cuenca. Se recolectaron 50 muestras (30 de dos quirófanos y 20 de la sala de cuidados intensivos). S. aureus se identificó por pruebas fenotípicas y detección molecular del gen nuc. La susceptibilidad a meticilina y penicilina se determinó por el método de difusión del disco en agar y los genes blaZ y mecA por reacción en cadena de la polimerasa. La frecuencia de S. aureus fue de 6% (3/50 cepas). La resistencia a penicilina y meticilina fue de 66,6% (2/3 cepas). Los genes blaZ y mecA se detectaron en las dos cepas resistentes a penicilina y meticilina. La baja frecuencia de S. aureus puede estar relacionada con los ambientes analizados; ya que, las superficies muestreadas son áreas donde se hace énfasis en la aplicación de protocolos de higiene y desinfección para asegurar una adecuada descontaminación.

RecibidoReceived: 2019 July 20; AceptadoAccepted: 2019 September 3; Publicación en línea: 2019 September 10

km. 2019 ; 47(02)
doi: 10.5281/zenodo.3406805

Copyright

©2019. Los Autores. Kasmera. Publicación del Departamento de Enfermedades Infecciosas y Tropicales de la Facultad de Medicina. Universidad del Zulia. Maracaibo-Venezuela. Este es un artículo de acceso abierto distribuido bajo los términos de la licencia que permite el uso no comercial, distribución y reproducción sin restricciones en cualquier medio, siempre y cuando la obra original sea debidamente citada.

Keywords: Palabras claves: Staphylococcus aureus, quirófano, infección hospitalaria, resistencia a penicilina, resistencia a la meticilina.
Keywords: Keywords: Staphylococcus aureus, operating rooms, cross infection, Penicillin Resistance, Methicillin Resistance.

Introducción

Staphylococcus aureus forma parte de la microbiota de la piel y las superficies mucosas de humanos y animales. Este microorganismo es considerado uno de los más frecuentes y de mayor significado clínico, se asocia con una diversidad de enfermedades que incluyen infecciones en piel y tejido blando hasta procesos infecciosos severos, tales como: bacteriemia, endocarditis, neumonía, meningitis, infecciones de heridas quirúrgicas y síndrome de shock tóxico 1,2. S. aureus produce una serie de factores de virulencia y enzimas extracelulares que se relacionan con la severidad de los cuadros clínicos; además, tiene una alta capacidad para adquirir resistencia a los antibióticos, lo cual puede implicar mayores complicaciones debido a dificultades con el tratamiento antimicrobiano 1.

A nivel mundial, las infecciones adquiridas en el hospital constituyen un importante problema de salud pública debido a la morbi-mortalidad que ocasionan. Según un estudio auspiciado por la Organización Mundial de la Salud, realizado en 55 hospitales de 14 países de las regiones de Europa, Mediterráneo Este, Sureste Asiático y Pacífico Oeste, el 8,7% de los pacientes hospitalizados adquieren infecciones relacionadas con los cuidados de salud 3.

S. aureus es uno de los principales patógenos asociados con infecciones adquiridas en el hospital. Es un microorganismo altamente invasivo y considerado como el principal responsable de infecciones del tracto respiratorio inferior e infecciones de heridas quirúrgicas y la segunda causa de bacteriemia intrahospitalaria, neumonía e infecciones cardiovasculares 4-9. Por otra parte, la emergencia de cepas resistentes a meticilina, las cuales suelen ser multirresistentes, agrava el problema, puesto que, las infecciones intrahospitalarias producidas por S. aureus resistente a meticilina (SARM) incrementan la morbi-mortalidad, prolongan la estancia hospitalaria y aumentan los costos derivados del uso de terapia antimicrobiana. Se estima que, en países en vías de desarrollo más del 30% de las infecciones adquiridas en instituciones hospitalarias son producidas por SARM 10.

S. aureus es un microrganismo ampliamente distribuido en el ambiente hospitalario y constituye un reto para los programas de control epidemiológico de las infecciones intrahospitalarias. Es comúnmente hallado en las fosas nasales y las manos del personal de salud; así como, en superficies como pisos, paredes, techos, mesas, interruptores eléctricos, manillas de puertas, camas, aparatos electrónicos, equipos de computación, fómites, instrumentos y equipos médicos; los cuales se convierten en potenciales reservorios y vehículos de transmisión de infecciones entre los pacientes 5,11,12.

La mayoría de las infecciones adquiridas en el hospital son de origen endógeno; siendo la microbiota del paciente la principal fuente. Sin embargo, el contacto con otros pacientes infectados o colonizados, el personal de salud y el ambiente hospitalario constituyen fuentes exógenas para la adquisición de patógenos hospitalarios 13. Se estima que, aproximadamente, de 20-40% de las infecciones intrahospitalarias tienen su origen en contaminación cruzada a través de las manos del personal de salud en contacto directo con los pacientes o, indirectamente, por contacto con superficies ambientales contaminadas 6,14.

La contribución de las superficies ambientales en la transmisión de patógenos intrahospitalarios está relacionada con diversos factores, incluyendo: la habilidad del microorganismo para permanecer viable en superficies inanimadas secas, la frecuencia con la cual los pacientes y el personal de salud entran en contacto con las superficies comúnmente contaminadas y los niveles de contaminación suficientemente altos como para permitir la transmisión a los pacientes 15.

Si bien está establecido que la diseminación de bacterias intrahospitalarias tiene causas multifactoriales y depende, en gran parte, de la interacción entre el hospedero, el microorganismo y el entorno; los factores considerados más importantes para la diseminación de S. aureus en los centros hospitalarios se relacionan con la capacidad de adaptación de la bacteria a diversas condiciones ambientales, la aglomeración de pacientes en espacios físicos reducidos, el incumplimiento de las normas básicas de asepsia y fallas en la identificación temprana de los portadores del microorganismo 8.

En vista de la importancia de S. aureus como patógeno intrahospitalario, investigar su presencia en los ambientes de instituciones de atención en salud, puede aportar datos para establecer el papel que desempeñan las superficies inertes como reservorios y fuente de transmisión de este microrganismo entre pacientes hospitalizados y personal de salud. Por lo tanto, la presente investigación tiene como objetivo analizar la frecuencia y los patrones de susceptibilidad a penicilina y meticilina de S. aureus aislados de la unidad de cuidados intensivos (UCI) y las salas de cirugía de un centro hospitalario de Cuenca, Ecuador.

Métodos

Tipo y diseño de la investigación:

el estudio realizado fue de tipo no experimental, descriptivo, ya que, durante el proceso de investigación no se manipularon variables, ni condiciones de experimentación; sólo se observó y describió el comportamiento de las variables. El diseño de la investigación es transversal, puesto que, los datos se recolectaron y evaluaron durante un tiempo establecido; es decir, se seleccionaron los ambientes hospitalarios, se tomaron las muestras y se analizaron mediante técnicas de laboratorio, con el objetivo de evaluar las variables en estudio.

Muestra:

los ambientes hospitalarios seleccionados para el estudio fueron los dos quirófanos y la sala de cuidados intensivos con dos camas, existentes en un Hospital de la ciudad de Cuenca. Se recolectaron 50 muestras de materiales instrumentales, equipos médicos y superficies de las áreas mencionadas, distribuidas de la siguiente manera: 15 de cada uno de los dos quirófanos y 10 de cada una de las dos camas ubicadas en la UCI. El muestreo fue aleatorio simple.

Para su inclusión en este estudio, se seleccionaron los ambientes hospitalarios considerados como áreas críticas para la adquisición de infecciones intrahospitalarias, puesto que, en ellos se aplican procedimientos invasivos, relacionados con los cuidados de salud de los pacientes, los cuales aumentan la posibilidad de contaminación de las superficies ambientales, instrumentos y equipos médicos. Se excluyeron aquellos ambientes que, por la naturaleza de la atención prestada, no representan áreas de riesgo de contaminación microbiana.

Las muestras fueron recolectadas por duplicado con la ayuda de un hisopo de algodón estéril humedecido con caldo soya tripticasa (CST), el cual se frotó sobre las superficies de contacto frecuente (manijas de cortinas, interruptores, piso, mesa para materiales, ventanas y lámparas), materiales instrumentales y equipos médicos y se colocó en un tubo conteniendo CST. El procesamiento de las muestras se ejecutó en el laboratorio de Biología Molecular y Genética del Centro de Investigación, Innovación y Transferencia de Tecnología, Universidad Católica de Cuenca.

Metodología:

previo a su análisis bacteriológico, las muestras fueron incubadas en aerobiosis por 4 horas a 35-37°C. Posteriormente, se inocularon en agar manitol salado e incubaron en condiciones de aerobiosis, a una temperatura entre 35-37°C, durante 24-48 horas. Transcurrido el período de incubación, se procedió a la identificación presuntiva mediante la selección de colonias fermentadoras del manitol, con características morfológicas de microorganismos pertenecientes al género Staphylococcus. A partir de estas colonias se realizó un extendido coloreado mediante la técnica de Gram. Si se observaban cocos Gram positivos con predominio de racimos, se efectuó la identificación definitiva mediante pruebas fenotípicas y detección genética del gen nuc16, que codifica para una nucleasa específica de S. aureus.

La identificación fenotípica de S. aureus se realizó mediante la fermentación en agar manitol salado y las reacciones positivas de las pruebas de coagulasa y desoxirribonucleasa (DNAsa).

Determinación fenotípica de susceptibilidad a antibióticos beta lactámicos:

la susceptibilidad a penicilina y oxacilina de los aislamientos de S. aureus se determinó mediante el método de difusión del disco en agar, siguiendo los lineamientos del Instituto para la Estandarización de Laboratorios Clínicos (CLSI, por sus siglas en inglés) 17. Para tal fin, se preparó con cada una de las cepas de S. aureus a analizar, un inóculo bacteriano espectrofotométricamente estandarizado con el patrón 0,5 del nefelómetro de MacFarland (625nm; DO: 0,8-1,0). Con esta suspensión, se inoculó una placa de agar Müeller Hinton sobre la cual se colocaron los discos de antibióticos penicilina G(10U) y oxacilina (1µg). Las placas se incubaron en condiciones de aerobiosis, por 18-24 horas a 35°C. Luego, se procedió a la lectura, midiendo los diámetros de los halos de inhibición y los resultados se interpretaron de acuerdo con los criterios del CLSI como: sensibles, intermedios o resistentes.

Extracción de ADN:

para la extracción de ADN de las cepas de S. aureus se utilizó el método de lisis alcalina, el cual se describe brevemente a continuación: Se suspendieron colonias de S. aureus en 1ml de agua destilada, se centrifugó 10 minutos a 3000rpm y se descartó el sobrenadante, se agregaron 50µl de solución de lisis formada por dodecilsulfato sódico al 1% en NaOH 0,25N, se mezcló y se hirvió por 15 minutos, se añadieron 450µl de agua libre de nucleasas y se centrifugó por 20 segundos. El ADN extraído se conservó a -20°C.

Identificación genotípica de S. aureus:

la identificación molecular de las cepas de S. aureus se realizó mediante prueba de reacción en cadena de la polimerasa (PCR) utilizando iniciadores específicos para amplificar el gen nuc que codifica para una nucleasa específica de especie 16. El producto amplificado, iniciadores y condiciones de amplificación se muestran en la Tabla 1. Como controles positivos, se utilizó S. aureus ATCC® 11632 y S. aureus ATCC® 43300 y como control negativo Streptococcus pyogenes (S. pyogenes) ATCC® 12344.

Detección genotípica de resistencia a beta-lactámicos:

la técnica de PCR fue utilizada para la detección molecular de los genes blaZ y mecA, que codifican para resistencia a penicilina y meticilina, respectivamente 18-20. En la Tabla 1 se indican los iniciadores, productos amplificados y condiciones de amplificación. Como controles positivos se utilizaron las cepas ATCC® 11632 (blaZ +) y ATCC® 43300 (mecA +) y como control negativo, S. pyogenes ATCC® 12344.

Todas las reacciones de PCR, tanto para la detección del gen nuc como para los genes blaZ y mecA, se llevaron a cabo en un volumen total de 20μl conteniendo: 10μl de Mastermix GoTaq Green 2X de Promega con 400μM de cada uno de los dNTP y 3mM MgCl2, 1,5μl de cada iniciador, 1,5μl del ADN extraído y 5,5μl de agua pura.

Las amplificaciones se realizaron en un termociclador PIKO (Finnzymes) según los protocolos mencionados en la Tabla 1. La separación de los productos de PCR se realizó por electroforesis en geles de agarosa (1,5%p/v) sobre un cámara horizontal sumergidos en buffer TBE (Tris 90mM-Borato 90mM-EDTA 2mM) con Bromuro de Etidio al 0,5µg/ml, a 70V, 70A y 50 W por 2 horas. El tamaño de los productos de PCR se calculó de acuerdo con sus migraciones en los geles de agarosa comparándolo con la migración de las bandas de ADN patrón del marcador de peso molecular Trackit de Invitrogen (1 Kb Plus DNA ladder) y se fotografiaron sobre un transiluminador con una cámara digital.

Tabla 1.

Iniciadores, producto amplificado y condiciones de amplificación de genes nuc, blaZ y mecA


Producto amplificado (pb) Secuencia del iniciador 5’-3’ Condición de amplificación Referencia
nuc (218) Forward: GACTATTATTGGTTGATCCACCTG Reverse: GCCTTGACGAACTAAAGCTTCG 94 °C 5 min 30 ciclos: 94°C 1 min 54°C 1 min 72°C 1 min 72°C 10 min (Elongación final) Depardieu y col, 2004
blaZ (674) Forward: GTTGCGAACTCTTGAATAGG Reverse: GGAGAATAAGCAACTATATCATC 94 °C 5 min 34 ciclos: 94°C 1 min 54°C 1 min 72°C 1 min 72°C 10 min (Elongación final) Olsen y col, 2006
mecA (310) Forward: GTAGAAATGACTGAACGTCCGATGA Reverse: CCAATTCCACATTGTTTCGGTCTAA 94 °C 5 min 30 ciclos: 94°C 1 min 62°C 30 seg 72°C 35 seg 72°C 10 min (Elongación final) Elhassan y col, 2015; Harrison y col, 2014

Análisis estadístico:

los datos obtenidos fueron organizados en tablas y figuras. El análisis estadístico se realizó utilizando el paquete estadístico SPSSTM versión 19.0 (SPSS, Inc. Chicago, USA) para Windows TM . Para establecer si existe alguna relación de asociación entre el ambiente hospitalario y la presencia de S. aureus se utilizó el estadístico de contraste X 2 (Chi-cuadrado), con un nivel de significancia del 95%.

Resultados

En este estudio, se demostró una frecuencia de 6% de S. aureus contaminando las superficies de los ambientes hospitalarios analizados. La distribución de las cepas obtenidas fue la siguiente: un aislamiento procedió de una mascarilla utilizada para anestesia general perteneciente al quirófano 1; mientras que, las otras dos cepas se aislaron de muestras obtenidas de un dispositivo de succión y de un equipo de intubación, ambos dispuestos en el perímetro correspondiente a la cama 1 de la UCI. No se recuperó S. aureus de los especímenes provenientes del quirófano 2 y de las adyacencias a la cama 2 de la UCI (Tabla 2).

Las 3 cepas identificadas por pruebas bioquímicas como S. aureus amplificaron el fragmento 218pb, correspondiente al gen nuc, lo cual confirman su identificación genotípica.

Tabla 2.

Distribución de S. aureus en muestras ambientales de un centro hospitalario.


Ambiente Positivo N (%) Negativo N (%)
Quirófano 1 1(6,6) 14(93,4)
Quirófano 2 0 15(100)
Sala de cuidados intensivos Cama 1 2(20) 8(80)
Sala de cuidados intensivos Cama 2 0 10(100)
Total 3(6) 50(94)

De las 3 cepas S. aureus aisladas a partir de muestras ambientales, 2 (66,6%) fueron resistentes a penicilina y meticilina, por el método de difusión del disco en agar, mientras que, una cepa resultó sensible a estos dos antimicrobianos.

En relación con la detección de los genes de resistencia a beta-lactámicos, las dos cepas resistentes, por el método fenotípico, amplificaron los fragmentos 674pb y 310pb, por lo tanto, poseen los genes blaZ y mecA, que codifican para resistencia a penicilina y meticilina, respectivamente (Figuras 1 y 2).


[Figure ID: f1] Figura 1.

Productos de PCR para el gen blaZ (674pb) en S. aureus aislados de ambientes hospitalarios: carril 1: marcador de PM; carril 2 cepa control positivo; carriles 3 cepa control negativo; carriles 4 cepa negativa: carriles 5 y 6, cepas positivas.



[Figure ID: f2] Figura 2.

Producto de PCR para el gen mecA (310 pb) en S. aureus aislados de ambientes hospitalarios: Carril 1 marcador de PM, Carril 2 cepa control positivo, Carril 3 cepa control negativo, carril 4 cepa negativa, carriles 5 y 6 cepas positivas.


Discusión

Las superficies ambientales, fómites, equipos e instrumentos médicos son reconocidos como importantes reservorios de patógenos intrahospitalarios productores de infecciones asociadas con cuidados de salud. En este estudio, mediante el cual se evaluó la presencia de S. aureus en dos quirófanos y una UCI, se recuperó este microorganismo en 6% de las muestras analizadas. Los resultados de esta investigación coinciden con los reportados por Chávez y col 8, quienes analizaron la frecuencia de S. aureus en varios servicios de un hospital de Cali-Colombia y comunicaron 6,1% de aislamiento en la UCI. De igual modo, Al-Abdli y BIau 21, reportaron 10% de S. aureus en la unidad de diálisis de un hospital de Libia; sin embargo, estos autores comunicaron un porcentaje de recuperación de este microrganismo en la UCI de 23,8%, lo cual discrepa de los resultados de este estudio.

Otros autores han hallado porcentajes ligeramente superiores a los encontrados en este estudio. Así, Gharsa y col 1, en un estudio realizado en diferentes servicios de un hospital de Tunes, reportaron 12% de S. aureus; estos aislamientos fueron recuperados en diferentes unidades, mostrando una amplia distribución de este microorganismo en el ambiente hospitalario. Otros autores, Ekrami y col 22, Mukhiya y col 23, Tagoe y Desbordes 24, evaluaron la presencia de esta bacteria en muestras provenientes de diversas superficies hospitalarias y reportaron porcentajes de positividad similares que oscilan entre 13,7-14,42%.

Al contrastar las publicaciones de otros autores con los resultados de la contaminación de los ambientes hospitalarios evaluados en esta investigación, se aprecia una notable discrepancia en la frecuencia de aislamiento de S. aureus. En este sentido, Rivera y col 5, en un estudio realizado en un hospital de Perú, recuperaron 26,6% de S. aureus en muestras provenientes de salas de cirugía y salas de parto: mientras que, Oie y col 25, en un centro de servicios de salud japonés, comunicaron 27% de aislamiento de este microorganismo en especímenes recolectados de superficies inanimadas. Por otra parte, Odoya y col 4, en un hospital nigeriano, indican contaminación por este agente microbiano superior al 50% en especímenes ambientales de diversas áreas hospitalarias.

Las variaciones en el aislamiento de patógenos hospitalarios, como S. aureus, pueden relacionarse con factores como la técnica de muestreo, los métodos de cultivo y aislamiento bacteriano, la facilidad y grado de contaminación de las superficies y objetos inanimados, la capacidad de la cepa de mantenerse viable por períodos prolongados en ambientes secos, la resistencia bacteriana a los desinfectantes y antisépticos utilizados para la limpieza, la aglomeración de pacientes y personal en las salas de servicios de salud, la falta de protocolos estandarizados para la higiene y desinfección de los ambientes hospitalarios, la frecuencia de brotes epidémicos en el hospital y la rotación de pacientes en las camas hospitalarias 15,26.

Investigaciones a nivel mundial han analizado la distribución de S. aureus en ambientes hospitalarios y; en general, existe consenso en cuanto a que estas áreas constituyen reservorios de este patógeno. No obstante, el papel de estas superficies como fuente de infección estafilocócica es controversial. Por una parte, Price y col 27, en un estudio realizado en un centro de salud, encontraron que, aunque esta bacteria es frecuentemente aislada en la UCI, sólo en dos casos demostraron asociación directa entre el medio ambiente y la adquisición de infección por S. aureus. Por otra parte, otros autores 14 indican que, cuando los pacientes ocupan camas dejadas por otros, quienes han padecido infecciones intrahospitalarias, tienen una mayor probabilidad de infectarse con el mismo patógeno; lo cual evidencia como las camas y las superficies adyacentes representan fuentes de contaminación microbiana.

Otros estudios han asociado la contaminación de las superficies ambientales con la mitad de las epidemias por SARM en diversos hospitales. Además, los datos de un estudio retrospectivo, realizado por Watson y col 28, entre 2005-2009, en diferentes hospitales de California, Estados Unidos; establecieron una asociación entre la contaminación ambiental y la transmisión de SARM y; además, se demostró que la inclusión de protocolos estrictos de limpieza, favorecen la protección de los pacientes contra infecciones intrahospitalarias.

Desde el descubrimiento de la penicilina, en 1940, el uso de este antibiótico para el tratamiento de infecciones por S. aureus y el rápido desarrollo de resistencia antimicrobiana han sido ampliamente documentados. En la actualidad, aproximadamente, el 90% de las cepas aisladas de cuadros clínicos son resistentes a penicilina 18. Ahora bien, los asilamientos de muestras ambientales obtenidos en esta investigación mostraron una alta resistencia a penicilina, puesto que, de las 3 cepas de S. aureus aisladas, 2 (66,6%) presentaron el gen blaZ y el fenotipo de resistencia a penicilina.

Numerosas investigaciones científicas han evaluado la susceptibilidad a meticilina de S. aureus aislados a partir de muestras clínicas y de ambientes hospitalarios. Las cepas resistentes a este antibiótico también lo son a la mayoría de los antimicrobianos beta-lactámicos 1; además, los aislamientos resistentes a meticilina suelen portar genes de resistencia a múltiples antibióticos, lo cual puede limitar el uso de otros antimicrobianos para el tratamiento de cuadros clínicos provocados por SARM.

El porcentaje de resistencia a meticilina de las cepas ambientales de S. aureus aisladas en esta investigación fue de 66,6% (2/3), resultados similares han sido reportados por Wille y col 29, quienes comunicaron 64% de aislamientos resistentes a meticilina en muestras de superficies inanimadas. De igual modo, Ekrami y col 22, analizaron el comportamiento frente a este agente antimicrobiano de cepas de S. aureus obtenidas de muestras del medio ambiente de siete hospitales iraníes y publicaron 60% de resistencia.

Otros autores Chávez y col, en Colombia 8; Mukhiya y col 23, en Nepal y Al-Abdli 21, en Libia; analizaron los patrones de susceptibilidad a meticilina en aislados de diferentes áreas hospitalarias y encontraron entre 32-45,9% de resistencia a este antimicrobiano.

En contraste con los resultados de este estudio, Price y col 27, evaluaron la transmisión de S. aureus entre trabajadores de salud, medio ambiente y pacientes de una UCI. Durante el análisis, los autores obtuvieron 12,92% de resistencia a meticilina en las cepas de S. aureus ambientales.

En conclusión, la baja frecuencia de aislamientos de S. aureus en este estudio puede estar relacionada con los ambientes muestreados; ya que, las superficies examinadas están ubicadas en áreas en las cuales se hace énfasis en la aplicación de protocolos de higiene y desinfección para asegurar una adecuada descontaminación. Por otra parte, el volumen de pacientes atendidos en el hospital es relativamente bajo; por lo tanto, no existen condiciones de hacinamiento debidas a la aglomeración de pacientes y personal de salud, que faciliten la transmisión de microorganismos. Además, la media de estancia hospitalaria es baja, lo cual disminuye las posibilidades de transmisión de patógenos entre los pacientes. No obstante, es necesario el análisis de otras salas del hospital, para evaluar su papel como posibles reservorios de S. aureus y otros patógenos intrahospitalarios.

En vista que, la mayoría de los aislamientos de S. aureus obtenidos portaban genes de resistencia a penicilina y meticilina, es recomendable mantener medidas de vigilancia epidemiológica de la resistencia de las cepas aisladas, tanto de pacientes como de superficies ambientales, a fin de controlar la diseminación de cepas multirresistentes, principalmente SARM; importante patógeno intrahospitalario productor de procesos infecciosos graves que pueden prolongar la estancia hospitalaria, generar altos costos y comprometer la vida del paciente.

Esta investigación se vio limitada por la falta de protocolos estandarizados para la evaluación de la contaminación microbiana de los ambientes hospitalarios.


Referencias Bibliográficas
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20. Harrison .
21.
22.
23.
24.
25.
26.
27.
28.
29.

Enlaces refback

  • No hay ningún enlace refback.




Copyright (c) 2019 Carlos Andrade T, Paola Orellana B

Licencia de Creative Commons
Este obra está bajo una licencia de Creative Commons Reconocimiento-NoComercial-CompartirIgual 4.0 Internacional.

Departamento de Enfermedades infecciosas y Tropicales. Facultad de Medicina. Universidad del Zulia / Maracaibo / Venezuela / Kasmera / e-mail: revistakasmera@gmail.com  / P-ISSN 0075-5222 / E-ISSN 2477-9628

 

Licencia de Creative Commons
Este obra en Acceso Abierto (Open Access) está amparada bajo una licencia Creative Commons Reconocimiento-NoComercial-CompartirIgual 4.0 Internacional.

 Biblioteca Digital Revicyhluz de Revistas Científicas y Humanísticas pertenecientes al Sistema de Servicios Bibliotecarios y de Información, Serbiluz, de la Universidad del Zulia, LUZ; Maracaibo, Venezuela