40-51

Kasmera 46(1): 40-51, Enero-Junio 2018

P-ISSN: 0075-5222   E-ISSN: 2477-9628

Detección de cassette cromosómico en cepas de Staphylococcus aureus resistente a meticilina aisladas en un hospital universitario de la ciudad de Maracaibo

Detection of chromosomal cassette in MRSA Staphylococcus aureus strains isolated in a University Hospital in Maracaibo City

Romero A. Sonia. Bacteriología General. Escuela de Bioanálisis. Universidad del Zulia-Venezuela.

Castellano G. Maribel. Bacteriología General. Escuela de Bioanálisis. Universidad del Zulia-Venezuela.

Perozo-Mena, Armindo. Práctica Profesional de Bacteriología. Escuela de Bioanálisis. Universidad del Zulia-Venezuela.

Rincón V. Gresleida. Bacteriología Clínica. Escuela de Bioanálisis. Universidad del Zulia-Venezuela.

Zabala R, Diana. Estudiante Escuela de Medicina. Universidad del Zulia-Venezuela.

Autor de correspondencia: Sonia Romero. E-mail: sromero272@hotmail.com

Resumen

Staphylococcus aureus resistente a meticilina, es un importante patógeno nosocomial y comunitario. El determinante genético de resistencia es el gen mecA. Se han descrito 11 tipos de SCCmec, encontrándose con frecuencia los tipos II, III en infecciones hospitalarias, y los tipos IV y V en infecciones comunitarias. La presente investigación se llevó a cabo para estudiar la distribución de los tipos de SCCmec y su relación con la Leucocidina Panton-Valentine, tipificados mediante la reacción en Cadena de la Polimerasa. Para ello se estudiaron un total de 42 cepas resistentes a meticilina portadoras del gen mecA. Veintinueve (29) cepas mostraron la presencia del cassette cromosomal tipo IV (69,05%); 30,95% presentaron el SCCmec tipo I. Un 61,95% (n=13) de las cepas fueron portadoras del SCCmec IV resultando todas positivas para el gen PVL. Cabe destacar la diseminación del cassette tipo IV en cepas intrahospitalarias portadoras de PVL, lo que es preocupante tanto para la terapéutica como para el agravamiento de las infecciones en los pacientes.

Palabras clave: Staphylococcus aureus resistente a meticilina; técnicas de tipificación

Abstract

Methicillin-resistant Staphylococcus aureus is an important nosocomial and community pathogen. The genetic determinant of resistance is the mecA gene. 11 types of SCCmec have been described, with types II, III frequently found in hospital infections, and types IV and V in community infections. The present investigation was carried out to study the distribution of the SCCmec types and their relation with the Panton-Valentine Leucocidin, typified by the reaction in the Polymerase Chain. To this end, a total of 42 methicillin-resistant strains carrying the mecA gene were studied. Twenty-nine (29) strains showed the presence of type IV chromosomal cassette (69.05%); 30.95% presented SCCmec type I. A 61.95% (n= 13) of the strains were carriers of SCCmec IV, all of which were positive for the PVL gene. It is worth noting the dissemination of the type IV cassette in intrahospital strains carrying PVL, which is worrisome both for the therapeutic and for the aggravation of infections in patients.

Keywords: Methicillin Resistant Staphylococcus aureus; bacterial typing techniques; virulence factors

Recibido: 14/02/2018 / Aceptado: 07/03/2018

Introducción

S. aureus resistentes a la meticilina (SARM) es un importante patógeno asociado a infecciones hospitalarias y en la comunidad en todo el mundo con tasas de morbi-mortalidad significativas de 15-60% (1); de allí el actual interés sobre el estudio de este patógeno ya que representa una de las principales causas de brotes de infección nosocomial a nivel mundial, convirtiendo determinadas áreas en zonas endémicas (2,3,4).

La resistencia a meticilina es conferida por el gen mecA, que en S. aureus no es endógeno y se encuentra integrado al cromosoma bacteriano. El producto de expresión de este gen es una proteína de unión a la penicilina (siglas en inglés penicillin binding protein: PBP), llamada PBP2´ o PBP2a (1,2,3,5). Este gen se encuentra dentro de un elemento cromosomal móvil heterogéneo, designado como cassette cromosómico estafilocócico (siglas en inglés: SCC) que se encuentra exclusivamente en el género Staphylococcus (6). Además, este elemento puede contener también genes de resistencia a otros antibióticos no β-lactámicos en transposones o en copias integradas de plásmidos (1,2,6).

El SCCmec consta de tres regiones: un complejo mec que lleva mecA, y sus genes reguladores mecI y mecR1; un complejo ccr que transporta genes de recombinasas (ccr) que codifica recombinasas específicas de sitio, ccrA/B; y una serie de regiones J no codificantes (J1, J2 y J3) que, aunque son componentes no esenciales, en algunos casos llevan otros factores determinantes de resistencia (1,6). Este elemento genético se encuentra en especies estafilococicas coagulasa negativas y se cree constituyen un reservorio para la adquisición de SSCmec (2,5).

Hasta la fecha, la recombinación entre los complejos de genes mecA y ccr, han generado 11 tipos de SCCmec. (I-XI): los tipos I, II, III y VIII están típicamente asociados a infecciones hospitalarias; mientras que los tipos IV, V, VI y VII a infecciones comunitarias (2,5,7,8,9). Estos últimos, generalmente presentes en SARM asociado a la comunidad (10).

En los últimos años se han observado cambios importantes en la epidemiologia de las infecciones causadas por SARM, ya que tradicionalmente su adquisición era exclusiva de centros de salud o ambientes hospitalarios (SARM-AH). Sin embargo, existen reportes recientes que destacan el aislamiento de SARM asociado a la comunidad (SARM-AC) en guarderías, escuelas, bases militares, equipos deportivos, entre otros (11). Tres importantes marcadores genotípicos distinguen los aislamientos de SARM-AH y SARM-AC: su linaje genético, la arquitectura del SSCmec y la presencia de la Leucocidina de Panton Valentine (Panton-Valentine leukocidin; PVL, por sus siglas en inglés) (13). Esta citotoxina está compuesta por dos proteínas designadas S y F, codificadas por dos genes cotranscriptos lukS-PV y lukF-PV (lukS/F-PV) (11,14,15).

Investigaciones epidemiológicas y bioquímicas apuntan hacia un papel para PVL en la patogénesis, pero el efecto de esta toxina en la presentación clínica de enfermedad invasiva, hasta ahora no está claro, ya que son escasos los estudios experimentales con modelos animales (11). Cabe destacar que en este artículo los términos de S aureus productores PVL o portadores PVL, denotan aislados de S aureus que contienen los genes PVL.

Hasta el año 2003, las infecciones asociadas con cepas productoras de PVL eran predominantemente asociadas con SARM-AC, pero los aislados del clon USA300 de SARM, que tiene la capacidad de diseminarse a nivel mundial, ha convertido a estas cepas en una causa común de infección asociada a la asistencia sanitaria (11). Sin embargo, numerosos estudios reseñan que la distinción entre SARM-AH y SARM-AC ha comenzado a desaparecer, por la aparición de cepas SARM- AC dentro del ámbito hospitalario, siendo endémicas en muchos hospitales, constituyendo una amenaza significativa para la salud pública (10,16,17). Además, estudios han demostrado que la asociación epidemiológica entre SARM-AC y la toxina PVL está lejos de ser absoluto, ya que existen varias cepas PVL negativas descritas en todo el mundo (11,18).

El considerable aumento de la resistencia, observado en los últimos años, incrementa claramente las cifras de indicadores de salud y el costo hospitalario en todo el mundo, lo que conlleva a ser uno de los mayores retos terapéuticos en la actualidad (3,4). Por lo antes expuesto, el presente estudio tiene como objetivo la tipificación del elemento SCCmec y su relación con la Leucocidina de Panton Valentine en cepas SARM aisladas en un hospital universitario de la ciudad de Maracaibo.

Material y Método

Cepas de estudio: este estudio se llevó a cabo a partir de 42 aislamientos clínicos de SARM, obtenidos de distintos tipos de muestras de pacientes atendidos en el Servicio Autónomo Hospital Universitario de Maracaibo (SAHUM), procesadas e identificadas en el laboratorio de bacteriología de este centro hospitalario, en el lapso comprendido entre enero y marzo de 2015. Las muestras fueron procesadas de acuerdo a la metodología convencional (18) y las cepas fueron identificadas utilizando el sistema automatizado VITEK 2 (Biomérieux®).

Prueba de susceptibilidad antimicrobiana: la determinación de la susceptibilidad antimicrobiana se realizó en el laboratorio antes mencionado, mediante el método de Kirby & Bauer de acuerdo a los lineamientos del Instituto para la Estandarización de Laboratorios Clínicos (CLSI) (19). La información obtenida fue procesada mediante el programa WHONET TM (versión 5,6).

Determinación de la resistencia a meticilina: la resistencia a meticilina fue evaluada empleando el método de difusión en agar, utilizando un disco de cefoxitina (30ug) (19). La presencia de resistencia a este antibiótico fue verificada mediante la determinación del gen mecA a través de la reacción en cadena de la polimerasa (PCR).

Estudios de Caracterización Molecular. Extracción del ADN: para la extracción del ADN genómico de estas cepas, se utilizó la técnica de lisis enzimática para lo cual, a partir de un cultivo puro de 24 horas se tomaron aproximadamente un mínimo  de 10 colonias,  y se resuspendieron en un tubo con 400 µl de buffer TE (10mM Tris-HCl, pH 8,0; 1 mM EDTA, pH 8,0; 25 ng/µl de lisostafina), como buffer de lisis, incubándose a 37°C por 1 hora. Luego, se le agregó 40 µl de SDS (dodecil-sulfato de sodio) al 1% y 10 µl de proteinasa K a una concentración de 250 ng/µl, y se incubó a 50ºC por 1 hora. Se tomaron 400 µl de la mezcla y se realizó la extracción con una solución de fenol-cloroformo 1:1. Luego se agitó y se centrifugó a 14.000 rpm por 20 minutos. Con una pipeta, se extrajo la fase acuosa, colocándola en un nuevo tubo eppendorf. El ADN contenido en la fase acuosa fue precipitado con 1 ml de etanol absoluto (100%) y se almacenó a -20°C durante toda la noche. Al día siguiente, previa descongelación, se procedió a centrifugar a 14.000 rpm durante 10 minutos descartándose el sobrenadante y al sedimento, se le agregó 400 µl de etanol al 70% y se dejó secar durante 30 minutos, colocando los tubos eppendorf destapados sobre un papel absorbente. El sedimento se resuspendió en 100 µl de buffer TE 10 mM. Para realizar los ensayos de amplificación se utilizaron 3 µl de la muestra.

Amplificación del gen mecA: para la detección del gen mecA, así como la detección del RNAr 16s, para la verificación de la identificación de S. aureus se utilizaron los protocolos descritos por Martineau y col (20) y Borras (15), respectivamente. Los iniciadores utilizados durante el proceso de amplificación para estos genes y para el control positivo específico de Staphylococcus se pueden observar en la Tabla 1. Un volumen de 5 µl de los productos de la amplificación, fueron sometidos a una separación mediante electroforesis en gel de agarosa al 2,5% conteniendo 0,5 µg/ ml de bromuro de etidio, en buffer tris-borato-EDTA (89 mM Tris, 89 mM ácido bórico, 2 mM EDTA) a 80 V/cm, durante 90 minutos. Los geles fueron visualizados bajo luz ultravioleta (254 nm) y se fotografiaron con una cámara digital. El tamaño de los productos de amplificación de la PCR se estimó por comparación con un marcador de peso molecular de 100 a 1500pb, y van de 100 en 100. De manera que todas las cepas amplificaron la banda de 108 pb, correspondiente al control interno para la identificación de S. aureus (RNAr 16s), la presencia de una banda de 174 pb indicó la presencia de mecA.

Tabla 1. Iniciadores utilizados para la detección de los genes mecA y cepas de S. aureus

Gen

Secuencia de Iniciadores

Amplicon

mecA

5’-AAC AGG TGA ATT ATT AGC ACT TGT AAG-3’

5’-ATT GCT GTT AAT ATT TTT TGA GTT GAA-3’

174 pb

16s RNAr Staphylococcus

5’-AAT CTT TGT CGG TAC ACG ATA TTC TTC ACG-3’

5’-CGT AAT GAG ATT TCA GTA GAT AAT ACA ACA-3’

108 pb

Martineau y col (20) y Borras (15)

Al realizar estadístico c2, no se encontró asociación significativa entre el tipo de SCCmec, la presencia de PVL y el tipo de muestra clínica, con el origen de las cepas analizadas.

Determinación del tipo Cassette Cromosómico Estafilocócico (SCCmec): la tipificación del complejo SSCmec y sus variantes se realizó mediante la PCR múltiple e incluyó la amplificación de 8 locus diferentes (A hasta H), según lo descrito por Oliveira y De Lencastre (21). Se incluyó un control positivo con el gen mecA. La relación de cada locus con el tipo de SSCmec, los iniciadores utilizados y el tamaño del amplicón están descritos en la Tabla 2. Los datos obtenidos en este estudio fueron analizados en forma porcentual, y organizados en tablas y/o gráficos. Para establecer si existe asociación entre la producción de PVL y el tipo de SSCmec de las cepas SARM, se aplicó el estadístico c2 con un grado de confiabilidad del 95%. Se empleó el Software estadístico SPSS (Statistical Package for Social Sciences), versión 21.

Tabla 2. Iniciadores empleados para la amplificación del tipo de SCCmec

Locus

Iniciadores

Secuencia (5´-3´)

Tamaño del amplificado (pb)

Tipo SCCmec

A

CIF2 F2

TTCGAGTTGCTGATGAAGAAGG

495

I

CIF2 R2

ATTTACCACAAGGACTACCAGC

B

KDP F1

AATCATCTGCCATTGGTGATGC

284

II

KDP R1

CGAATGAAGTGAAAGAAAGTGG

C

MECI P2

ATCAAGACTTGCATTCAGGC

209

II, III

MECI P3

GCGGTTTCAATTCACTTGTC

D

DCS F2

CATCCTATGATAGCTTGGTC

342

I, II, IV

DCS R1

CTAAATCATAGCCATGACCCG

E

RIF4 F3

GTGATTGTTCGAGATATGTGG

243

III

RIF4 R9

CGCTTTATCTGTATCTATCGC

F

RIF5 F10

TTCTTAAGTACACGCTGAATCG

414

III

RIF5 R13

GTCACAGTAATTCCATCAATGC

G

IS431 P4

CAGGTCTCTTTCAGATCTACG

381

IA

Pub110 R1

GAGCCATAAACACCAATAGCC

H

IS431 P4

CAGGTCTCTTCAGATCTACG

303

IIIA

pT181 R1

GAAGAATGGGGAAAGCTTCAC

mecA

mecA-1

GTAGAAATGACTGAACGTCCGATAA

310

Control interno

mecA-2

CCAATTCCACATTGTTTCGGTCATA

Oliveira y Lencastre H (21).

Resultados

Todas las cepas examinadas amplificaron los fragmentos de 108 pb y 174 pb (mecA), lo que indicó que fueron S. aureus resistente a meticilina (Figura 1).


Figura 1. Amplificación mediante PCR del gen mecA en cepas de SARM aisladas en el CRB-SAHUM. Año 2018.

Los carriles 1 al 6 muestran 2 bandas: una superior que concierne a la amplificación del gen mecA (174 pb) y una inferior que representa al control interno para la identificación de S. aureus (108 pb).

La Figura 2 muestra los patrones de bandas para cada tipo de cassette cromosómico (SCCmec) de las cepas SARM aisladas. La distribución de los tipos del cassette cromosómico de las cepas SARM aisladas en esta investigación se muestra en la Figura 2, observándose que el cassette cromosómico tipo SCCmec IV es el tipo más frecuente (69,05%) entre las cepas SARM estudiadas.


Figura 2. Patrones de bandas de SSCmec. SARM aisladas en el CRB-SAHUM. Año 2018

Carril 1 MPM (100bp); carriles del 2 al 8 controles positivos (carril 2 SSCmec tipo I; carril 3 SSCmec tipo IA; carril 4 SSCmec tipo II; carril 5 SSCmec tipo III; carril 6 SSCmec tipo IIIA; carril 7 SSCmec tipo IIIB y carril 8 SSCmec tipo IV). Carriles del 9 a 21 muestras

Los genes lukS/F-PV fueron detectados en una investigación anterior, realizada en un hospital universitario de esta ciudad donde se encontraron 21 cepas positivas (50,00%) para estos genes (22). La relación entre la presencia de estos genes con el tipo de SSCmec se presenta en la Tabla 3. Trece cepas 13 (61,95%) presentaron cassette cromosómico tipo IV y 8 (38,05%) SCCmec tipo I.

Tabla 3. Correlación entre Tipos de SSCmec y genes lukS/F-PV. Cepas SARM aisladas en el CRB- SAHUM. Año 2018

Tipo SSCmec

genes lukS/F-PV

Valor p

Positivo

Negativa

I (%)

8 (38,05)

5 (23,81)

 

IV (%)

13 (61,95)

16 (76,19)

0,317a

Total (%)

21 (100,00)

21 (100,00)

 

aValor significativo p < 0,05


Figura 3. Distribución de SSCmec. SARM aisladas en el CRB-SAHUM. Año 2018

Los 42 aislamientos de SARM estudiados en esta investigación provenían de diferentes tipos de muestras clínicas (secreciones de heridas, oído, ocular, ulceras, traqueales, abscesos, sangre). Los resultados obtenidos en la determinación de los tipos de SSCmec según el tipo de muestra clínica se observan en la Tabla 4. Puede apreciarse que del total de cepas positivas, el mayor porcentaje de aislamientos con cassette cromosomal tipo IV provenía de muestras de piel y tejido blando.

Tabla 4. Distribución de tipo SSCmec según el tipo de muestra clínica. Cepas SARM aisladas en el CRB-SAHUM. Año 2018

Muestras

Tipo SSCmec

Valor p

I (%)

IV (%)

PTBa

11 (26,19)

20 (47,62)

 

Sangre

-

4 (9,52)

0,348c

Otrasb

2 (4,76)

5 (11,91)

 

Total (%)

13 (30,95)

29 (69,05)

 

a Piel y tejido blando; b catéter, secreción traqueal, oído externo y conjuntiva; c valor significativo p < 0,05

Discusión

Desde la aparición del SARM en 1961, se ha observado un aumento constante en la prevalencia de este tipo de cepas en todo el mundo. Esta bacteria se ha esparcido de tal forma que hoy es el patógeno resistente más diseminado del mundo y es considerado un problema de salud pública (23). Esta bacteria se ha convertido en un patógeno hospitalario endémico en numerosos países. América Latina no es una excepción, variados resultados son encontrados en nuestro país donde en la zona central la frecuencia de resistencia a meticilina de esta especie fue 14% (2004) y 68% (2007) y 24,79%, respectivamente según Borga y col (24) y Dorante y col (25). En nuestra región Gómez y col (26) obtuvieron una prevalencia de SARM intrahospitalario de 13,86% (56/404). La caracterización molecular mostró que todos los aislamientos SARM transportaron el gen mecA.

Aún no está claro el origen del gen mecA pero se ha propuesto que pudo haber evolucionado, en especies de estafilococos libres de penicilinasas que se encontraban bajo presión selectiva por la penicilina, cuando se inició su utilización intensiva como medida profiláctica en veterinaria, luego de su introducción para el uso en humanos. En este contexto, se presenta el Staphylococcus sciuri, debido a que esta especie presenta un gen mecA homólogo, con un alto porcentaje de similitud con el de S. aureus. La mayoría de los aislamientos de esta especie fueron susceptibles a antibióticos β-lactámicos, incluyendo la meticilina; sin embargo, se ha demostrado que las cepas susceptibles pueden ser convertidas a resistentes en el laboratorio, lo que revela su facilidad de  adquirir resistencia (27).

En esta investigación, el SCCmec más frecuente fue el tipo IV (69,05%), seguido del tipo I (30,95%). Estos resultados coinciden con los reportados por varios investigadores (8,28,29) quienes evaluaron la distribución SCCmec en cepas de S. aureus aisladas en hospitales ubicados en Venezuela y Colombia, y obtuvieron entre 54-79% tipo IV y entre 16-33% tipo I. Además, Jiménez y col (30), demostraron que en los hospitales de Medellín la prevalencia de SCCmec tipo IV aumento de 50% en 2008 a 68% en 2010. En contraste, los resultados de esta investigación discrepan con los obtenidos por Acuña, 2008 (31), quien realizo una investigación en la región oriental de Venezuela y encontró SCCmec tipo I (66,67%) y tipo IV (14,28%), lo cual sugiere la existencia de variaciones en la distribución de los SCCmec de acuerdo con la localización geográfica de los aislamientos. En nuestra región en 2014, Castellano y col (7), refieren, el SCCmec más frecuentemente encontrado fue el tipo IV (54%), seguido del tipo I (22%); situación similar a la descrita en esta investigación.

Otros autores encuentran otros perfiles de SCCmec en aislamientos de S. aureus. Así, Sánchez y col (5) al caracterizar los tipos de SSCmec reportaron 51% tipo IV, 41,5% tipo I y 2,5% tipo II. De igual modo, en Brasil, Pacheco y col (32), publicaron que los principales tipos de SCCmec eran tipo IV (50%) y tipo III (46%). No obstante, Caiaffa-Filho y col (33) en el mismo país, informaron un predomino del SCCmec tipo II seguido de tipo IV y III. Otros investigadores (34) presentan resultados en los cuales se observa que todas las cepas de SARM aisladas de un hospital brasileño presentaron el SCCmec tipo III.

En otras investigaciones, se observa una mayor diversidad de tipos de SCCmec en cepas SARM. Así, en Paquistán, Atif, 2014 (35), presentó el siguiente perfil: 47% tipo III, 29% tipo IV, 9% tipo II y 3% tipo I. Por otra parte, Taherirad y col (36) recuperan SCCmec tipo III (76%), tipo IV (11%), tipo I (5%) y tipo V (3,2%). De la misma forma, Mehdi y col (37) informan 30,5% tipo I, 25% tipo II, 22,2% tipo IV y 8,3 tipo III.

En otros estudios se obtuvieron perfiles que incluyen combinaciones de tres tipos de SCCmec. Así, Momtaz y col (38), recuperaron SCCmec V (52.83%), SCCmec III (24.52%), SCCmec IV (22,61%). De igual modo, Elshabrawy y col (39) reportaron 60,7% tipo I, 25% tipo III y 14,3% tipo II.

Se han descrito diferencias fenotípicas y moleculares entre cepas de SARM-AH y SARM- AC. Tradicionalmente, las cepas SARM-AH llevan SCCmec tipo I-III, mientras que las cepas SARM-AC transportan SCCmec IV y V. No obstante, el SCCmec tipo IV se ha presentado en aislamientos recientes en hospitales, este cambio en la epidemiología hospitalaria ha tenido impacto en las opciones terapéuticas para las infecciones relacionadas con estas cepas. Aunque existen diferencias genéticas entre las cepas adquiridas en la comunidad y las cepas aisladas de hospitales, ambas conservan genes de virulencia comunes como mecA y los codificadores de PVL entre otros (8).

En relación con los tipos de SCCmec y detección del gen PVL, en este estudio, se encontró que 13 cepas hospitalarias de SARM (61,95%) portaban el SSCmec tipo IV y genes que codifican la PVL. Este hallazgo difiere con los resultados presentados por Castellano y col (7) quienes en un trabajo realizado en un hospital universitario de la ciudad de Maracaibo, mostraron que 35% de cepas portadoras de SCCmec IV y también presentaron genes que codifican para la PVL.

En la literatura consultada existe una diversidad de hallazgos en relación con la presencia de SSCmec tipo IV y genes de la PVL. Así, Moussa y col (40) estudiaron los genotipos de SARM de Riyadh y hallaron que las cepas de SARM-AC, albergaban el elemento tipo SCCmec IV y los genes de PVL. Por otra parte, Moroney y col (16), informaron que 23 (92%) aislados de SCCmec tipo IV fueron positivos para PVL.

Investigaciones efectuadas en Colombia, reportaron variaciones en cuanto a la presencia de estos genes, en los resultados mostrados por Sánchez y col (5) se observa 93,5%depositividad. Mientras otros autores (29), reportaron 40% (12/30) en cepas SASM y 6 (66,7%) de los 9 aislamientos SARM; de las cuales, 7 (5,4%) correspondían a cepas hospitalarias.

Aunque la función de PVL en la patogénesis y severidad de infecciones estafilocócicas es aún controversial, el hallazgo de los genes de la leucocidina PVL en aislamientos SARM, pudiera representar un agravante y factor de riesgo relevante para las infecciones por S. aureus, teniendo en cuenta que algunas investigaciones sugieren que la portación de los genes PVL en las cepas de S. aureus aumenta su virulencia y es responsable de infecciones graves tales como las óseas, articulares y neumonía necrotizante (14,29).

En relación con los tipos de SCCmec y su relación con el gen PVL en este estudio, se encontró que 13 cepas (61,95%) de SARM-AH SSCmec tipo IV, poseían genes que codifican la PVL, diferentes resultados mostraron investigadores en esta localidad (8), quienes reportaron 35% de positividad para PVL en cepas de SARM SCCmec tipo IV. Igualmente, Jiménez y col (30), observaron que los genes lukS/F-PV estaban presentes en todos los tipos de SCCmec encontrados, pero se observaron con mayor frecuencia en aislamientos tipo SCCmec IV (95%).

En un estudio realizado en un hospital universitario de Colombia, se detectaron los genes lukS/F-PV en un 88% (38/43) de los aislados de SARM y estuvieron presentes en todos los tipos de SCCmec identificados con porcentajes que van desde un 100% y 86% entre los SCCmec tipo IV y SCCmec de tipo I, respectivamente (29).

Una investigación realizada en Pakistán por Atif, 2014 (35) reportó, que un 19% de los aislamientos de SARM albergaba el gen PVL y de estos en su mayoría fueron SCCmec tipo III (42,1%) y los tipos IV en un 47,3%.

Los genes PVL se asocian sistemáticamente con las infecciones de la piel y los tejidos blandos y son comparativamente raros en las enfermedades invasivas (neumonía, infecciones musculoesqueléticas, bacteriemias). Este hallazgo desafía la opinión de que la PVL causa principalmente enfermedades invasivas con pronóstico precario. Se necesitan estudios poblacionales para definir el papel de la PVL en la enfermedad leve, moderada y grave y para informar las estrategias de control (11).

La correlación entre el tipo de muestra y la distribución de los tipos de SSCmec, no arrojaron diferencias estadísticamente significativas, observándose aislamientos con el cassette cromosómico tipo IV con mayor frecuencia en muestras de piel y tejido blando (47,62%).

Aunque el gen PVL generalmente se asocia con muestras adquiridas en la comunidad, se ha detectado este gen en SARM SCCmec tipo III en cepas hospitalarias (35). Existen pocos estudios para la vigilancia de la PVL en este tipo de cassette cromosomal estafilococico. Sin embargo, Mimica y col.  (41)  publicaron un estudio en el que encontraron cuatro aislamientos SCCmec tipo IV y cuatro SCCmec tipo III en pacientes hospitalizados con fibrosis quística y ninguno de ellos portaba el gen PVL.

Machuca, y col (29), detectaron genes de la PVL en 88 % de los SARM siendo portadores del SCCmec IV y SCCmec I, solo los aislamientos SCCmec IV fueron asociados con infecciones adquiridas en la comunidad (47%) y en las hospitalarias en un 53% con compromiso de piel y tejidos blandos, y en los casos más graves, con compromiso osteoarticular.

En un estudio realizado en Irán se observaron que cepas de tipo I solo se aislaron de hemocultivos, mientras que las cepas tipo IV y V fueron asociadas principalmente con heridas y muestras de orina; las cepas de tipo III, sin embargo, se detectaron en todos los especímenes (37). Estos resultados difieren por completo en los obtenidos en esta investigación donde en orina no se obtuvo ningún aislamiento SARM y las cepas encontradas en hemocultivos presentaron SSCmec tipo IV.

En conclusión los resultados de este trabajo, revelan el aislamiento de cepas SARM, con predominio de los tipos de SCCmec IV y I circulantes en el centro hospitalario, y que ambos tipos de cassette cromosómicos portan el determinante PVL, existiendo un mayor predominio en las cepas SCCmec tipo IV; datos importantes para comprender la evolución de la epidemiología de la infección por S. aureus en humanos y animales, no sólo para  un tratamiento antimicrobiano adecuado y un control eficaz de la infección, sino también para controlar la evolución de la especie. Por lo tanto, se necesitan esfuerzos continuos de tipificación fenotípica y genotípica de los aislamientos obtenidos, para entender el comportamiento y distribución de este patógeno.

Referencias Bibliográficas

  1. El-Hamid M. Staphylococcal Chromosome mec (SCCmec) in Methicillin-Resistant Staphylococcus aureus: An Overview. Adv Tech Clin Microbiol. 2016;1(1):1-2.
  2. Sánchez L, Pavas N, Rojas A, Pérez N. Infecciones por Staphylococcus aureus resistente a la meticilina adquirido en la comunidad en pacientes de Villavicencio, Colombia. Rev Cubana Med Trop. 2016;68(1). Disponible en línea en: http://www.revmedtropical.sld.cu/index. php/medtropical/article/view/125/109 [Acceso03.08.2017].
  3. Cervantes E, García R, Salazar P. Características generales del Staphylococcus aureus. Rev Latinoam Patol Clin Med Lab. 2014;61(1):28-40.
  4. Echavarría J, Iglesias D. Estafilococo Meticilino resistente, un problema actual en la emergencia de resistencia entre los Gram positivos. Rev Med Hered 2003;14(4):195-203.
  5. Sánchez M, Hernández O, Velásquez L, Rivas D, Marín A, González L et al. Caracterización del gen mecA de Staphylococcus aureus resistentes a meticilina aislados de tres grupos poblacionales de la ciudad de Medellín. Infectio. 2013;17(2):66-72.
  6. Nidhi B, Mohini D, Varun C, Mohd. Azhar K, Umar F. Pathogenesis of PVL positive methicillin resistance Staphylococcus aureus isolates on human Peripheral Blood Mononuclear cell. J of Microbiol and Antimicrob Agent. 2017;3(1):11-17.
  7. Castellano M, Cavazza M y Perozo-Mena A. Tipo de cassette cromosómico estafilocócico en cepas clínicas de Staphylococcus aureus resistentes a meticilina. Kasmera. 2014;42(2):116-130.
  8. International Working Group of Classification of Staphylococcal cassette chromosome mec elements. Disponible en línea en: www.sccmec.org/Pages/SCC_TypesEN.html [acceso03.05.2017].
  9. Deurenberg R and Stobberingh E. The evolution of Staphylococcus aureus. Infect. Genet. Evol. 2008;8:747-763.
  10. Shallcross, L, Fragaszy E, Johnson A, Hayward A. The role of the Panton-Valentine leucocidin toxin in staphylococcal disease: a systematic review and meta-analysis. Lancet Infect Dis 2013;13:43-54.
  11. Lozano D, Díaz L, Echeverry M, Pineda S, Máttar S. Staphylococcus aureus resistentes a meticilina (SARM) positivos para PVL aislados en individuos sanos de Montería-Córdoba. Universitas Scientiarum. 2010;15(2):159-165.
  12. Giusti A, Baroni M, Mendosa M, Nagel A, Virgolini S, Ochoteco C, et al. Staphylococcus aureus meticilino-resistente adquirida en la comunidad: Detección de leucocidina de Panton-Valentine y su relación con el sitio de aislamiento en pacientes de la ciudad de Santa Fe-Argentina. Rev Panam Infectol 2011;13(2):8-11.
  13. Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter M, Gauduchon V, et al. Involvement of        Panton-Valentine-Leukocidin-Producing Staphylococcus aureus in Primary Skin Infections and Pneumonia. Clin Infect Dis 1999;29(5):1128-1132.
  14. Osman N, Alrayah I, Mohamed Y, El-Eragi A, Eldirdery M, Salih M. Molecular study of Panton-Valentine Leukocidin genes among Staphylococcus aureus clinical isolates in Khartoum State, Sudan. American J Microbiol Research, 2015;3(3):107-111.
  15. Borras C. 2006. Epidemiología de la resistencia a meticilina en cepas de Staphylococcus aureus aisladas en hospitales españoles. Programa de Doctorado: Microbiología Médica. Departamento de Patología y Terapéutica Experimental. Facultad de Medicina. Universidad de Barcelona. España. (Tesis Doctoral). Disponible en línea en: http://www.tesisenred.net/TDX/TDX_UB/TESIS/AVAILABLE/TDX102.710.6105221//CBO_TESIS_DOCTORAL.pdf. [acceso 10.09.2015].
  16. Moroney S, Arbuckle J, Talavera M, Widen R. Staphylococcal cassette chromosome mec and Panton-Valentine leukocidin Characterization of Methicillin Resistant Staphylococcus aureus Clones. J Clin Microbiol 2007;45:1019-1021.
  17. Day N. Panton-valentine leucocidin and staphylococcal disease The Lancet Infect Dis.2013;13(1):5-6. Disponible en línea en: http: www.thelancet.com/infection. [acceso06.11.2016].
  18. Becker K, Skov R, Von Eiff C. Staphylococcus, Micrococcus, and Other Catalase-Positive Cocci. In: Jorgensen J. Editors. Manual of Clinical Microbiology. 11th ed. ASM Press. Washington, DC;2015. pp.354-382.
  19. CLSI (Clinical Laboratory Standardization Institute). Performance Standards for Antimicrobial Susceptibility. Informational Supplement. Document M100, 27th ed Vol: 37, Nº1.2017; pp:128-141.
  20. Martineau F, Picard F, Lansac N, Menard C, Roy P, Ouellette M, et al. Correlation between the Resistance Genotype Determined by Multiplex PCR Assays and the Antibiotic Susceptibility Patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob Agents Chemother 2000;44(2):231-238.
  21. Oliveira D, De Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 2002;46:2155-2161.
  22. Romero S, Castellano M, Ginestre M, Perozo-Mena A. Leucocidina de Panton Valentine en cepas SAMR aisladas de pacientes del Hospital Universitario de Maracaibo. Kasmera. 2016;44(2):111-120
  23. Olarte N, Valderrama I, Reyes K, Garzón M, Escobar J, Castro B, et al. Colonización por Staphylococcus aureus resistente a la meticilina en una unidad de cuidados intensivos de adultos de un hospital colombiano: caracterización fenotípica y molecular con detección de un clon de circulación en la comunidad. Biomédica. 2010;30(3):353-361.
  24. Borga G, Caiafa G, Fernández M, González F, Silva M, Caldera J, et al. Frecuencia y resistencia bacteriana de Staphylococcus aureus en infecciones nosocomiales en el Hospital Universitario de Caracas, años 2004 y 2007. CIMEL. 2010;15 (1):28-30 Disponible en línea en: http://sisbib.unmsm.edu.pe/BVRevistas/cimel/v15_n1/pdf/a07v15n1.pdf. [acceso15.10.2017].
  25. Dorante V, Hurtado E, Bastidas B y Méndez M. Frecuencia de Staphylococcus aureus meticilino resistente en pacientes que asisten al laboratorio de microbiología del hospital “Los Samanes” estado Aragua. Odous Cientifica 2013;14(1):29-36. Disponible en línea en: http://servicio.bc.uc.edu.ve/odontologia/revista/vol14-n1/art04.pdf [acceso15.10.2017].
  26. Gómez L, Núñez D, Perozo A, Bermúdez J y Marín M. Staphylococcus aureus con resistencia múltiple a los antibióticos (MDR) en un Hospital de Maracaibo Venezuela. Kasmera. 2016;44(1):53-65.
  27. Jiménez J, Correa M. Staphylococcus aureus resistente a meticilina: bases moleculares de la resistencia, epidemiología y tipificación. Iatreia. 2009;22(2):147-158.
  28. Montes O, Milanés R, Álvarez A, Coronado S, Reyes N. Características moleculares y susceptibilidad a antibióticos de cepas de Staphylococcus aureus colonizantes de pacientes con patologías nasales procedentes de Cartagena (Colombia), 2015: estudio observacional. Archivos de Medicina 2015;15(2):226-240. Disponible en línea en: http://revistasum.umanizales.edu.co/ojs/index.php/archivosmedicina/article/view/743/1459. [acceso15.10.2017].
  29. Machuca M, Sosa L, González C. Methicillin-resistant Staphylococcus aureus causes both community-associated and health care-associated infections in children at the Hospital Universitario de Santander. Biomédica 2014;34(1):163-169.
  30. Jiménez J, Ocampo A, Vanegas J, Rodríguez E, Garcés C, Patiño L, et al. Characterization of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a pediatric population in a university hospital of Medellín, Colombia. Mem Inst Oswaldo Cruz, Rio de Janeiro, 2011;106(8):980-985.
  31. Acuña S. 2008. Caracterización Molecular de cepas de Staphylococcus meticilino resistentes aisladas en el Laboratorio de Bacteriología del Servicio Autónomo Hospital Universitario “Antonio Patricio De Alcalá” de Cumaná. Universidad de Oriente. Núcleo de Sucre. Escuela de Ciencias Departamento de Biología. Trabajo de Grado presentado como requisito parcial para Optar al título de Licenciado en Biología. Tutora: Dra. Lorena Abadía. Cumaná; Venezuela.
  32. Pacheco R, Lobo R, Oliveira M, Farina E, Santos C, Costa S, et al. Methicillin-resistant Staphylococcus aureus (MRSA) carriage in a dermatology unit. Clinics 2011;66:2071-2077.
  33. Caiaffa-Filho H, Trindade P, Gabriela da Cunha P, Alencar C, Prado G, Rossi F, et al. Methicillin-resistant Staphylococcus aureus carrying SCCmec type II was more frequent than the Brazilian endemic clone as a cause of nosocomial bacteremia. Diagn Microbiol Infect Dis 2013;76:518-520.
  34. Társis B, Miranda da Costa Th, Amorim J, Dutra M, Fernandes O, Aguiar F. Hospital-associated methicillin-resistant Staphylococcus aureus carrying the PVL gene outbreak in a Public Hospital in Rio de Janeiro, Brazil. Brazilian J of Microbiol. 2013;44(3):865-868.
  35. Atif A. Molecular characterization of methicillin-resistant Staphylococcus aureus isolated from tertiary care hospitals. Pak J Med Sci 2014;30(4):698-702.
  36. Taherirad A, Jahanbakhsh R, Shakeri F, Anvary S, Ghaemi E A. et al. Staphylococcal Cassette Chromosome mec Types Among Methicillin-Resistant Staphylococcus aureus in Northern Iran, Jundishapur J Microbiol. 2016;9(8):e33933. doi: 10.5812/jjm.33933.
  37. Mehdi A, Majid B, Nima B, Morovat
  38. T. Antibiotic Resistance Patterns and Virulence Determinants of Different SCCmec and Pulsotypes of Staphylococcus aureus Isolated from a Major Hospital in Ilam, Iran. Open Microbiol J. 2017;11:211-223 doi: 10.2174/1874285801711010211.
  39. Momtaz H, Hafezi B. Meticillin-resistant Staphylococcus aureus isolated from Iranian hospitals: virulence factors and antibiotic resistance properties Bosn J Basic Med Sci. 2014;14(4):219-226.
  40. Elshabrawy O, Elsayed M, Farag M. Genetic and phenotypic study of methicillin-resistant Staphylococcus aureus among patients and health care workers in Mansoura University Hospital, Egypt. Iran J. Microbiol. 2017;9(2):82-88.
  41. Moussa I, Kabli S, Hemeg H, Al-Garni S, Shibl A. A novel multiplex PCR for molecular characterization of methicillin resistant Staphylococcus aureus recovered from Jeddah, Kingdom of Saudi Arabia. Indian J Med Microbiol 2012;30:296-301.
  42. Mimica M, Berezin E, Damaceno N, Carvalho R. SCCmec Type IV, PVL-Negative, Methicillin-Resistant Staphylococcus aureus in Cystic Fibrosis Patients from Brazil. Curr Microbiol. 2011;62:388-90.

 

Enlaces refback





Copyright (c) 2019 Sonia Coromoto Romero-Añez, Maribel Josefina Castellano-González, Armindo José Perozo Mena, Gresleida Coromoto Rincón-Villalobos, Diana Patricia Zabala-Romero

Licencia de Creative Commons
Este obra está bajo una licencia de Creative Commons Reconocimiento-NoComercial-CompartirIgual 4.0 Internacional.

Departamento de Enfermedades infecciosas y Tropicales. Facultad de Medicina. Universidad del Zulia / Maracaibo / Venezuela / Kasmera / e-mail: revistakasmera@gmail.com  / P-ISSN 0075-5222 / E-ISSN 2477-9628

ReviCyHLUZ

Licencia de Creative Commons
Este obra está bajo una licencia de Creative Commons Reconocimiento-NoComercial-CompartirIgual 4.0 Internacional.