art1

Producción de biofilm y presencia de genes icaABCD en cepas de Staphylococcus aureus aisladas de leche cruda.

Biofilm production and presence of genes icaABCD in Staphylococcus aureus strains isolated from raw milk.

Ginestre P, Messaria1*; Ávila R, Yeiny1; Valero L, Kutchynskaya2; Rivera S, Jhoandry3; Briñez Z, Wilfrido4; Valeris C, Robert5.

1Bacteriolgía General. Escuela de Bioanálisis. Universdad del Zulia-Venezuela.

2Bacteriolgía Clínica. Escuela de Bioanálisis. Universdad del Zulia-Venezuela.

3Departamento de Biología. Facultad Experimental de Ciencias. Universidad del Zulia-Venezuela.

4 Infectología Veterinaria. Facultad de Ciencias Veterinarias. Universidad del Zulia-Venezuela

5 Control de Calidad e Higiene de los Alimentos. Facultad de Ciencias Veterinarias. Universidad del Zulia-Venezuela

*Autor de correspondencia: Messaria Ginestre.

Email: messaria@hotmail.com

Resumen

En la patogénesis de la mastitis estafilocócica, el biofilm se considera un marcador de virulencia que permite la adherencia del microorganismo al epitelio mamario. Con la finalidad de determinar la producción de biofilm y detectar la presencia de genes icaABCD, se analizaron 30 cepas de S. aureus aisladas de leche cruda obtenida de vacas con mastitis subclínica. El biofilm se determinó por el método cuantitativo sobre microplacas de cultivo celular y los genes icaABCD por reacción en cadena de la polimerasa. En 96,67% de las cepas de S. aureus se observó producción de biofilm. De éstas 43,34% fueron fuertes productoras, 30,00% moderadas productoras, 23,33% débiles productoras y 3,33% no productoras de biofilm. La totalidad de los genes icaADCD se obtuvo en 6,66% de los aislamientos. Todas las cepas, excepto una, presentaron icaA o icaD. En 56,66% de los aislamientos se identificaron genes icaA/icaD. En todas las cepas productoras de biofilm se identificaron genes del operón icaABCD, lo cual evidencia que poseen un factor de virulencia que facilita su persistencia en el tejido mamario. Además, el biofilm constituye una fuente de contaminación microbiana que puede conducir a fallas en los procesos de producción que generen problemas de inocuidad de los alimentos.

Palabras clave: Biofilm; S. aureus; genes ica; leche cruda.

Abstract

In the pathogenesis of staphylococcal mastitis the biofilm is considered a marker of virulence that allows the adhesion of the microorganism to the mammary epithelium. In order to determine the production of biofilm and the presence of icaABCD gene, 30 S. aureus strains isolated from raw milk obtained from cows with subclinical mastitis were analyzed. Biofilm production was determined by the quantitative method on microplates for cell culture and the presence of genes icaABCD by polymerase chain reaction. Biofilm production was observed in 96.67% of strains of S. aureus. These 43.34% were strong producers, 30.00% producing moderate, 23.33% weak producers and 3.33% non producing biofilm. All of the icaABCD genes was obtained at 6.66% of the isolates. All strains, except one, presented icaA or icaD. 56,66% of isolates identified genes icaA/icaD. The icaABCD operon genes were identified in all biofilm-producing strains, which demonstrates that they possess a virulence factor that facilitates its persistence in the breast tissue. In addition, the biofilm is a source of microbial contamination which can lead to failures in production processes that generate problems of food safety.

Key words: Biofilm; S. aureus; ica genes; raw milk.

Introducción

Staphylococcus aureus (S. aureus) es uno de los más importantes agentes causales de mastitis bovina, frecuentemente aislado de leche obtenida de vacas con infección subclínica. La patogénesis de la mastitis estafilocócica se atribuye a una combinación de factores extracelulares y toxinas, aunada con propiedades de la cepa, tales como adherencia y formación de biofilm (1).

La producción de biofilm es considerada un importante factor de virulencia en cepas de S. aureus productoras de mastitis bovina, puesto que, permite la adherencia de las bacterias al epitelio de las glándulas mamarias, facilita la persistencia del microorganismo en el tejido mamario, interfiere en la acción de los agentes antimicrobianos y protege a las células bacterianas de los mecanismos de defensa del hospedero (2,3,4). Diversos autores han demostrado que en el caso de mastitis bovina causada por especies de estafilococos, la capacidad de producir biofim es la razón más importante de las infecciones recurrentes y de problemas inusuales con la erradicación de la infección de las glándulas mamarias (1,2,4).

La expresión de los genes del operón icaABCD es un marcador de virulencia en S. aureus de importancia clínica, tanto en humanos como en animales, puesto que, codifica la producción del polisacárido de adhesión intercelular (PIA), considerado el principal y mejor caracterizado polisacárido constituyente del biofilm en este microorganismo. Según un estudio de Vasudevan y col (5) la presencia de los genes ica en cepas de S. aureus aisladas de mastitis, confirma su rol potencial como factor de virulencia en la patogénesis de la mastitis en bovinos.

La determinación de la formación de biofilm y la investigación de los genes involucrados en la elaboración del PIA, permiten evaluar in vitro estos dos importantes marcadores de virulencia en aislamientos de S. aureus. Por lo tanto, el objetivo de este trabajo fue analizar la producción fenotípica de biofilm y detectar la presencia de genes del locus de adherencia intercelular icaABCD, en cepas de S. aureus aisladas de leche cruda obtenida de vacas con mastitis subclínica.

Material y método

Se analizaron 30 cepas de S. aureus aisladas de leche cruda obtenida de vacas con mastitis subclínica. De estas cepas, 15 provenían de ganado bovino perteneciente a 3 fincas del Municipio Miranda y 15 de 2 fincas del Municipio La Cañada de Urdaneta, ubicados en el Estado Zulia, Venezuela.

Para la determinación de biofilm se utilizó el método cuantitativo sobre microplacas de cultivo celular propuesto por Christensens y col (6), el cual se describe brevemente: las cepas se inocularon CST-glucosado y se incubaron a 35°C ± 2°C 18-24h. A partir del crecimiento se preparó una dilución 1:100 en CST-glucosado y 200 µl se inocularon, por triplicado, en placas de microtitulación. Se utilizó 200 µl de CST-glucosado como control negativo y como control positivo de adhesión S. aureus ATCC 2592. Se incubó en aerobiosis durante 48 horas a 37°C. Luego, los cultivos se decantaron y se lavó tres veces con buffer PBS pH 7.4. El biofilm formado se fijó con acetato de sodio al 2% p/v por 15 minutos y se coloreó con cristal violeta al 1% p/v. Se lavó con agua desionizada y se secó a temperatura ambiente. La cuantificación del grado de producción de biofilm se realizó midiendo la densidad óptica a 630nm de la capa bacteriana adherida a las placas de microtitulación.

Para la extracción de ADN, las cepas de S. aureus se inocularon en caldo soya suplementado con 2% de glucosa y se incubaron a 36 ± 2ºC por 24 horas. Luego, se trasvasó una alícuota de cada cultivo a microtubos y se centrifugó a 14000 rpm por 10 minutos. El sedimento se lavó 2 veces con solución salina fisiológica al 0,8%, mediante centrifugación por 10 minutos a 14000rpm. Posteriormente, al sedimento se le añadió 100 µl de agua destilada estéril, se hirvió por 15-17 minutos, se centrifugó por 10 minutos a 14000rpm. El sobrenadante se trasvasó a un tubo estéril y se conservó a -20°C, hasta su utilización en las reacciones de amplificación por reacción en cadena de la polimerasa (PCR) (7).

Antes de las reacciones de amplificación de los genes ica, se realizó una PCR previa para verificar la fidelidad del ADN bacteriano, cuyo control se llevó a cabo con los cebadores diseñados por Greisen y col (8), para amplificar el gen 16S rRNA (16s-PLUS 3´-AGGAGGTGATCCAACCGCA-5´ y 16s-Minus 3´AACTGGAGGAAGGTGGGGAT-5´) y el gen nuc (Forward 3´- AAAGGGCAATACGCAAAGA-5´ y Reverse3´-TAGCCAAGCCTTGACGAACT-5´), específico para las cepas identificadas bioquímicamente como S. aureus (9). Adicionalmente, se incluyó un control de reacción, que consiste en un tubo conteniendo cada uno de los componentes de la mezcla de reacción, excepto el ADN muestra.

La detección de los genes del operón ica se realizó por PCR utilizando iniciadores específicos para la amplificación de los genes icaA, icaB, icaC (Kiem y col)(10) e icaD (11) (tabla 1). Las reacciones se realizaron en un volumen total de 25 μl conteniendo: 1,5 mM MgCl2, 0,2 μM de cada iniciador; Buffer Taq hasta 1X; 0,2 mM de la mezcla de dNTPs (dATP, dGTP, dCTP, dTTP); 4 μl del ADN extraído y 1,25 Unidades de Taq polimerasa.

La separación de los productos de PCR se realizó por electroforesis en geles de agarosa (2% p/v) en presencia de bromuro de etidio (0,5 µg/ml), según lo descrito por Ausbel y col (12). El tamaño de los productos de PCR se determinó según sus migraciones en los geles de agarosa comparándolo con la migración de las bandas de ADN estándar del marcador de peso molecular 100bp DN Ladder.

El análisis estadístico se realizó utilizando el paquete estadístico SPSSTM versión 19.0 (SPSS, Inc. Chicago, USA) para WindowsTM. Para establecer si existe alguna relación de asociación entre la formación de biofilm y la presencia de genes icaABCD se utilizó el estadístico de contraste X2 (Chi-cuadrado), con un nivel de confianza (α) de 0,05.

Resultados

En la figura 1 se observa la frecuencia y el grado de producción de biofilm según la capacidad de adherencia de los aislamientos en placas de poliestireno. En 29/30; 96,67% cepas de S. aureus evaluadas se observó producción de biofilm de acuerdo con los valores de DO630nm. De éstas, 13/30 (43,34%) fueron clasificadas como fuertes productoras (DO630nm entre 0,134-1,420), 9/30 (30,00%) catalogadas como moderadas productoras (DO630nm entre 0,091-0,132) y 7/30 (23,33%) registradas como débiles productoras (DO630nm entre 0,045-0,088). Sólo 1/30 (3,33%) de los aislamientos fue clasificado como no productor de biofilm debido a su bajo poder adherente sobre poliestireno (DO630nm 0,023).

Tabla 1. Iniciadores y condiciones de amplificación de genes icaABCD

Producto amplificado (pb)

Secuencia del iniciador 5’-3’

Condición de PCR

icaA

1200

Forward:

GGTAGGTAAAGAAATTGCAAT

icaB

900

Reverse:

AGCGTTGGGTATTCCCTCTGTCT

Forward:

AGAATCGTGAAGTATAGAAAATT

Reverse:

TCTAATCTTTTTCATGGAATCCGT

30 ciclos:

94 ºC 30 seg

55 ºC 1 min

72 ºC 1,5 min

icaC

1100

Forward:

ATGGGACGGATTCCATGAAAAAGA

Reverse:

TAATAAGCATTAATGTTCAATT

icaD

198 pb

Forward

ATG GTC AAG CCC AGA CAG AG

Reverse

CGT GTT TTC AAC ATT TAA TGC AA

94°C 5 min

50 ciclos:

94°C 30 seg

55,5°C 30 seg

72°C 30 seg

72°C 1 min (Extensión

final)

Figura 1. Producción de biofilm en S. aureus. Método cuantitativo sobre microplacas de cultivo celular

FP: Fuertes productoras

DP: Débiles productoras

MP: Moderadas productoras

NP: No productoras

Las figuras 2 y 3, muestran los resultados de la detección de los genes del operón icaABCD en algunas de las cepas evaluadas.

Al analizar los resultados de la identificación de genes del operón icaABCD se comprobó que aunque 96,67% de las cepas estudiadas produjeron biofilm por el método fenotípico, el comportamiento en la evaluación genotípica fue notablemente diferente. Como puede apreciarse en 2/30 (6,66%) cepas se evidenció la presencia de la totalidad de los genes que conforman el operón ica. Sin embargo, cuando se consideró sólo la presencia de los genes icaA o icaD se observó que todas las cepas presentaron uno de estos dos genes, en la mayoria de los casos junto con otros genes. La presencia de los genes icaA/icaD se demostró en 17/30 (56,66%) cepas, en algunos casos acompañados del gen icaB o de los genes icaB/icaC (tabla2).

Tabla 2. Perfil de genes del operón icaABCD en S. aureus aislados de lecha cruda

Genes ica

Cepas

%

icaA

3

10,00

icaD

5

16,67

icaAD

5

16,67

icaAB

1

3,33

icaDB

1

3,33

icaABC

2

6,67

icaABD

10

33,33

icaABCD

2

6,67

ninguno

1

3,33

Total

30

100

Discusión

En este estudio 96,67% de los aislamientos de S. aureus produjeron biofilm. Estos resultados coinciden con los obtenidos por varios autores, quienes han evaluado la producción de biofilm en cepas aisladas de leche mastítica. Así, De los Santos y col (13), Peña y Uffo (14) y De Castro y col (15) evaluaron la formación de biofilm en S aureus, provenientes de leche de tanque y leche de vaca con mastitis y obtuvieron entre 98-100% de aislamientos con capacidad de adherencia, utilizando el método cuantitativo sobre placas de cultivo celular. Además, Pereyra y col (16), analizaron el poder de adherencia de S. aureus, clasificados como persistentes y no persistentes, de acuerdo con su permanencia en el tejido mamario y comunicaron 100% de cepas productoras de biofilm en ambos grupos. Milanov y col (17), evaluaron 70 aislamientos de leche mastitíca y todos resultaron productores de biopelículas. De igual modo, Darwish y col (18) estudiaron S. aureus y obtuvieron 100% de cepas con poder de adherencia. Otro grupo de investigadores, Bardiau y col (19), Al-Rubaye y col (20) y Al-Iedani (21), hallaron entre 80-94% de aislamientos recolectados de leche cruda, con capacidad de adherencia sobre placas de poliestireno.

Al contrastar las publicaciones de otros autores con los resultados de esta investigación, se aprecia una notable discrepancia en la frecuencia de producción de biofilm de cepas S. aureus asociadas con mastitis bovina. En este sentido, Oliveira y col (22), caracterizaron como productoras de biopelículas in vitro a 18,75% cepas de S. aureus obtenidas de infecciones intramamarias. Dhanawade y col (23) informaron 29,41% de cepas adherentes relacionadas con mastitis subclínica. Otros autores, Szweda y col (24), Begum y col (25), Fox y col, (3), Vasudevan y col (5), recuperaron entre 40-67% especímenes de capacidad de adherencia a partir de muestras de leche.

En este estudio 13/30 (43,34%) cepas de S. aureus resultaron fuertes productoras, resultados similares han sido comunicados por Peña y Uffo (14), 40,8% y Darwish y col (18), 52,57%. En contraste, otros autores Begum y col (25), Milanov y col (17), Bardiau y col (19) indican una mayor recuperación de aislamientos moderados y débiles productores de biofilm.

Es notable la variabilidad que se observa en los estudios publicados a nivel mundial donde se analiza la producción fenotípica de biofilm y la presencia de genes ica, en cepas de S aureus aisladas de muestras de leche de bovinos con mastitis clínica y subclínica. La mayoría de las publicaciones evalúa los genes icaA e icaD, cuya presencia se relaciona directamente con la capacidad del microorganismo de producir el PIA, principal componente de la sustancia polimérica extracelular del biofilm (11,16,24).

Los resultados de esta investigación discrepan con los obtenidos por Vasudevan y col (26), Szweda y col (24), Melchior y col (4), quienes reportan la presencia de genes icaA e icaD en la totalidad de las cepas de S aureus aisladas de muestras de leche mastítica; sin embargo indican porcentajes de producción de biofilm que oscilan entre 57,6 y 97,5%. En otra investigación realizada por Melo y col (26), en Brasil, en la cual evaluaron cepas aisladas de vacas lecheras con mastitis subclínica, comunicaron un elevado porcentaje de cepas positivas para icaA/icaD y producción de biofim, 95,7% y 98,9%, respectivamente.

En contraste, otros autores encuentran resultados comparables con los obtenidos en esta investigación, en los cuales las cepas aisladas presentan una alta producción de biofilm por el método cuantitativo sobre microplacas de cultivo celular, que oscila entre 80-100%, pero no así para la amplificación de los genes icaA/icaD. De este modo, Marques y col en sus investigaciones (27, 28), al caracterizar feno-genotípicamente cepas de S aureus obtenidas de bovinos con infección intramamaria subclínica, recuperaron entre 81,6-100% de productoras de biofilm y entre 63,2-80% con genes icaA/icaD. Además, Darwish y col (18), en un estudio en el cual se evaluó 108 muestras de leche de vacas con mastitis subclínica demostraron 100% de formación de biofilm; sin embargo sólo 62,5% de las cepas presentaron el gen icaD, mientras que la recuperación de icaA fue muy baja (15%).

Otros investigadores han comunicado porcentajes de recuperación de genes icaA/icaD notablemente inferiores a los obtenidos en este estudio. Coehlo y col (29) analizaron 50 cepas de S aureus obtenidas de leche mastítica e informaron 80% de producción fenotípica de biofilm, aunque la demostración de amplificación de los genes icaA e icaD solo fue posible en 14% y 12%, respectivamente. Estos autores han propuesto que la falta de correlación entre la formación de biofilm y la demostración de productos de amplificación del locus icaABCD, podría deberse a la coexistencia de otros mecanismos de producción de biofilm en esta bacteria. En efecto, O’Gara (30) ha indicado que las delecciones en el operón ica no impiden la formación de biofilm, destacando la existencia de un mecanismo alternativo mediante el cual S. aureus expresa una variedad de adhesinas que le permiten unirse y colonizar diferentes superficies.

Para evaluar la asociación entre la producción de biofilm y la presencia de genes ica en las cepas de S. aureus estudiadas, se aplicó la prueba estadística chicuadrado. El valor p (>0,05) obtenido indica que no existe relación de dependencia entre las variables analizadas, es decir, que en estos aislamientos la formación de biofilm es independiente de los genes ica que codifican las proteínas para la síntesis del PIA. A pesar del papel que se le atribuye al PIA como principal exopolisacárido de la matriz del biofilm, Cucarrela y col (2), han propuesto que, además del locus ica, la producción de biofilm en S aureus también puede estar mediada por el gen bap (proteína asociada a biofilm) que codifica una proteína que promueve tanto la fijación inicial como la adhesión intercelular.

Un elevado porcentaje de las cepas de S aureus analizadas en este estudio fueron capaces de producir biofilm y portan genes del locus icaABCD, con lo cual se evidencia que las cepas aisladas a partir de leche cruda proveniente de vacas con mastitis subclínica, están dotadas de un importante factor de virulencia que facilita su adherencia y permanencia en el tejido mamario, promoviendo la persistencia de la infección intramamaria en el ganado productos de leche.

La elevada producción de biopelículas en las cepas de S aureus analizadas no solo debe ser considerada por su importancia en la patogénesis de la mastitis bovina; sino también, en la industria láctea donde la formación de biofilm constituye una fuente potencial de contaminación microbiana de las líneas de procesamiento de alimentos, lo cual puede conducir a fallas en los procesos de producción que generen problemas de inocuidad de los alimentos y la potencial transmisión de enfermedades.

Referencias

  1. Cramton S, Gerke C, Schnell N, Nichols W, Gotz F. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect Immun. 1999; 67: 5427-5433.
  2. Cucarella C, Tormo A, Ubeda C, Trotonda P, Monzon M, Peris C, et al. Role of biofilm associated protein Bap in the pathogenesis of bovine Staphylococcus aureus. Infect Immun, 2004; 72: 2177-2185.
  3. Fox L, Zadoks R, Gaskins C. Biofilm production by Staphylococcus aureus associated with intramammary infection. Vet Microbiol. 2005; 107:295-299. 16.
  4. Melchior M, Vaarkamp H, Fink J. Biofilms: A role in recurrent mastitis infections? Vet J. 2006; 171: 398-407.
  5. Vasudevan P, Nair M, Annamalai T, Venkitanarayanan K. Phenotypic and genotypic characterization of bovine mastitis isolates of Staphylococcus aureus for biofilm formation. Vet Microbiol. 2003; 92: 179-185.
  6. Christensen G, Simpson W, Younger J, Baddour L, Barrett F, Melton D, et al. Adherence of Coagulase-Negative Staphylococci to Plastic Tissue Culture Plates: a quantitative model for the adherence of Staphylococci to medical devices. J. Clin Microbiol 1985; 22: 996-1006.
  7. Aguiar F, Medeiros F, Fernandes O, Gudziki R, Perdreau F, Riley L. New Staphylococcus aureus genotyping method based on exotoxin (set) genes. J Clin Microbiol. 2004; 44: 2728-2732.
  8. Greisen K, Loeffelholz M, Purohit A, Leong D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J. Clin Microbiol. 1994; 32: 335-351.
  9. Ramesh A, Padmapriya B, Chrashekar A. Application of a convenient DNA extraction method and multiplex PCR for the direct detection of Staphylococcus aureus and Yersinia enterocolitica in milk samples. Mol Cell Probe. 2002; 16: 307314.
  10. Kiem S, Oh W, Peck K, Lee N, Lee J, Song J, et al. Phase variation of biofilm formation in Staphylococcus aureus by IS256 insertion and its impact on the capacity adhering to polyurethane surface. J Korean Med Sci. 2004; 19: 779-782.
  11. Gad G, El-Feky M, El-Rehewy M, Hassan M, Abolella H, El-Baky R. Detecton of icaA, icaD and bioflim production by Staphylococcus aureus and Staphylococcus epidermidis isolated from urinary tract catheterized patients. J Infect Dev Ctries. 2009; 3(5): 342-351.
  12. Ausubel F, Brent R, Kingston, R, Moore, D, Seidam J, Smith J, Struhl K.. Short protocols in molecular biology: a compendium of methods from current protocols in molecular biology. 5a edition, Vol. 2. John Wiley & Sons, Inc. USA. 2002. 1512 p.
  13. De los Santos R, Fernández M, Carro S, Zunino P. Characterisation of Staphylococcus aureus isolated from cases of bovine subclinical mastitis in two Uruguayan dairy farms. Arch Med Vet. 2014; 46(2): 315-320.
  14. Peña J, Uffo O. Producción de biofilm en genotipos de Staphylococcus aureus aislados de mastitis bovina en Cuba. Rev Salud Anim 2013; 35(3): 189196.
  15. De Castro P, Ferreira L, Filho A, Zafalon L, Vicente H, de Souza V. Comparison of methods for the detection of biofilm formation by Staphylococcus aureus isolated from bovine subclinical mastitis. Braz. J Microbiol. 2013; 44(1): 119-124.
  16. Pereyra E, Picech F, Renna M, Baravalle C, Andreotti C, Russi R, et al. Detection of Staphylococcus aureus adhesion and biofilm-producing genes and their expression during internalization in bovine mammary epithelial cells. Vet Microbiol. 2016; 1: 83:69-77.
  17. Milanov D, Laziæ S, Vidiae B, Petroviae J, Bugarski D, Šeguljev Z. Slime production and biofilm forming ability by Staphylococcus aureus bovine mastitis isolates. Acta Vet. 2010; 60(2-3):217-226.
  18. Darwish S. Asfour H. Investigation of Biofilm Forming ability in Staphylococci causing bovine mastitis using phenotypic and genotypic assays. Scientific World J. 2103; 1-9.
  19. Bardiau M, Detilleux J, Farnir F, Mainil J, Ote I. Associations between properties linked with persistence in a collection of Staphylococcus aureus isolates from bovine mastitis. Vet Microbiol. 2013; 12: 1-18.
  20. Al-Rubaye S, Al-Jumaily E, Abdul-Ratha H. Biofilm production by Staphylococcus aureus isolated from bovine mastitis related with resistance to the antibiotics. Int.J.Curr.Microbiol.App.Sci. 2016; 5(5): 33-44.
  21. Al-Iedani A. Phenotypic study on the capacity of biofilm production in Staphylococcus aureus isolated from bovine subclinical mastitis and their impact on resistance to antimicrobials. Bas J Vet Res. 2016; 15(2): 11-127.
  22. Oliveira M, Bexiga R, Nunes S, Carneiro C, Cavaco L, Bernardo F, Vilela C. Biofilm-forming ability profiling of Staphylococcus aureus and Staphylococcus epidermidis mastitis isolates. Vet Microbiol. 2006; 118(1-2): 133-140.
  23. Dhanawade N, Kalorey D, Srinivasan R, Barbuddhe S, Kurkure N. Detection of intercellular adhesion genes and biofilm production in Staphylococcus aureus isolated from bovine subclinical mastitis. Vet. Res. Commun. 2010; 34: 81-89.
  24. Szweda P, Schielmann M, Milewski S, Frankowska A, Jakubczak A. Biofilm production and presence of ica and bap genes in Staphylococcus aureus strains isolated from cows with mastitis in the Eastern Poland. Pol J Microbiol. 2012; 61(1): 65-69.
  25. Begum H, Uddin M, Islam M, Nazir K, Islam M, Rahman M. Detection of biofilm producing coagulase positive Staphylococcus aureus from bovine mastitis, their pigment production, hemolytic activity and antibiotic sensitivity pattern. J. Bangladesh Soc. Agric. Sci. Technol. 2007; 4: 97-100.
  26. Melo P, Menezes L, Nader A, Zafalon L, Godoy H, De Souza .Comparison of methods for the detection of biofilm formation by Staphylococcus aureus isolated from bovine subclinical mastitis. Braz J Microbiol. 2013; 44(1): 119-124.
  27. Marques V, De Souza M, Mendonça E, Abreu T, Rocha B, Coelho S, et al. Análise fenotípica e genotípica da virulência de Staphylococcus spp. e de sua dispersão clonal como contribuição ao estudo da mastite bovina. Pesq Vet Bras 2013; 33(2): 161-170.
  28. Marques V, Motta C, Soares B, Melo D, Coelho S, Coelho I et al. Biofilm production and beta-lactamic resistance in Brazilian Staphylococcus aureus isolates from bovine mastitis. Braz J Microbiol. 2017; 48(1): 118-124
  29. Coelho S, Pereira I, Soares L, Pribul B, Souza M. Short communication: Profile of virulence factors of Staphylococcus aureus isolated from subclinical bovine mastitis in the state of Rio de Janeiro, Brazil. J. Dairy Sci. 2011; 94(7): 3305-3310.
  30. O’Gara J, Humphreys H. (2001) Staphylococcus epidermidis biofilms importance and implications. J Med Microbiol. 2001; 50: 582-587.

Enlaces refback

  • No hay ningún enlace refback.




Copyright (c) 2017 Messaria Ginestre P., Yeiny Ávila R., Kutchynskaya Valero L., Jhoandry Rivera S., Wilfrido Briñez Z., Robert Valeris C.

Licencia de Creative Commons
Este obra está bajo una licencia de Creative Commons Reconocimiento-NoComercial-CompartirIgual 4.0 Internacional.

Departamento de Enfermedades infecciosas y Tropicales. Facultad de Medicina. Universidad del Zulia / Maracaibo / Venezuela / Kasmera / e-mail: revistakasmera@gmail.com  / P-ISSN 0075-5222 / E-ISSN 2477-9628

ReviCyHLUZ

Licencia de Creative Commons
Este obra está bajo una licencia de Creative Commons Reconocimiento-NoComercial-CompartirIgual 4.0 Internacional.