https://doi.org/10.52973/rcfcv-e34485
Received: 09/07/2024 Accepted: 25/09/2024 Published: 10/12/2024
1 of 5
Revista Científica, FCV-LUZ / Vol. XXXIV, rcfcv-e34485
ABSTRACT
Sheep production in Mexico encounters notable challenges, among
which infectious diseases stand out as a growing concern. Ovine
respiratory syndrome (ORS) is particularly problematic, being a
leading cause of economic losses in the industry. However, despite
its signicant negative impact, there remains a lack of comprehensive
understanding regarding the microorganisms involved. For this
reason, the aim of this study was to isolate and identify the causal
agents responsible for a respiratory disease outbreak in a sheep
production unit in Northern Veracruz. This included: collection of
samples from affected sheep, focusing on those displaying clinical
signs of respiratory illness; microbial culturing and molecular
identication of the isolated bacteria. We isolated rounded, raised
colonies with a pink mucoid aspect which were molecularly identied
as Enterobacter hormaechei, which exhibited a similarity of 99.59%
with sequences from China. The isolation and molecular identication
of E. hormaechei provide new insights into the pathogens affecting
sheep, highlighting the importance of continuous surveillance and
research in improving sheep health and production. This study
represents a signicant step in identifying and understanding the
causal agents of ORS in Northern Veracruz.
Key words: Enterobacteria; emerging pathogen; respiratory
complex; small ruminant; Mexico
RESUMEN
La producción ovina en México enfrenta desafíos notables, entre los
que destacan las enfermedades infecciosas como una preocupación
creciente. El síndrome respiratorio ovino (SRO) es particularmente
problemático y es una de las principales causas de pérdidas
económicas en la industria. Sin embargo, a pesar de su importante
impacto negativo, sigue existiendo una falta de comprensión
integral sobre los microorganismos involucrados. Por esta razón, el
objetivo de este estudio fue aislar e identicar los agentes causales
responsables de un brote de enfermedad respiratoria en una unidad de
producción ovina del Norte de Veracruz. Esto incluyó: recolección de
muestras de ovejas afectadas, centrándose en aquellas que presentan
signos clínicos de enfermedad respiratoria; cultivo microbiano e
identicación molecular de las bacterias aisladas. Aislamos colonias
redondeadas, elevadas, de aspecto mucoide rosado, que fueron
identificadas molecularmente como Enterobacter hormaechei,
las cuales exhibieron una similitud del 99,59% con secuencias
detectadas en China. El aislamiento y la identicación molecular
de E. hormaechei proporcionan nuevos conocimientos sobre los
patógenos que afectan a las ovejas, destacando la importancia de
la vigilancia y la investigación continuas para mejorar la salud y la
producción de las ovejas. Este estudio representa un paso importante
en la identicación y comprensión de los agentes causales de la SRO
en el norte de Veracruz.
Palabras clave: Enterobacteria; patógeno emergente; complejo
respiratorio; pequeños rumiantes; México
First isolation and molecular identication of Enterobacter hormaechei in a sheep
production unit with respiratory syndrome from Northern Veracruz, Mexico
Primer aislamiento e identicación molecular de Enterobacter hormaechei en una unidad de
producción de ovinos con presencia de síndrome respiratorio en el Norte de Veracruz, México
Javier Cruz Huerta–Peña
1
, Gabriela Romina Hernández–Carbajal
1
, Gerardo Gabriel Ballados–González
2
,
José Manuel Martínez–Hernández
2
, José Alfredo Villagómez–Cortés
2
, Sokani Sanchez–Montes
1
*
1
Universidad Veracruzana, Facultad de Ciencias Biológicas y Agropecuarias, región Poza Rica Tuxpan. Veracruz, Mexico.
2
Universidad Veracruzana, Facultad de Medicina Veterinaria y Zootecnia, Veracruz, Mexico.
*Corresponding author: sok10108@gmail.com
Isolation and molecular identification of Enterobacter hormaechei in sheep / Huerta–Peña et al. ___________________________________
2 of 5
INTRODUCTION
Sheep (Ovis aries) production in Mexico represents one of the
four most important sectors in the generation of animal protein
for national consumption. It is estimated that there are 5,714,882
sheep nationwide. In fact, Veracruz state is one of the top 10 states
in terms of sheep population, accounting for 4.40% of the national
production, with 251,322 animals in production units [1]. Particularly,
the North of Veracruz concentrates 25% of the state’s production,
which 62,903 animals.
Sheep national production indeed faces signicant challenges,
with infectious diseases emerging as a growing problem [2, 3]. Ovine
respiratory syndrome (ORS) represents one of the main causes of
economic losses because it affects 10% to 40% of sheep, being a
leading cause of death [4]. In lambs, this syndrome led to signicant
adverse effects such as mortality and poor quality of lambs produced
[4, 5]. The ORS is caused by a complex interaction of factors,
including the presence of opportunistic bacteria (key pathogens
involved include Mannheimia haemolytica, Bibersteinia trehalosi,
Pasteurella multocida, Mycoplasma spp., and Escherichia coli, which
are typically harmless but can invade the respiratory tract under
certain conditions, leading to disease), environmental conditions
(particularly, extreme temperature changes and poor ventilation),
and inadequate animal husbandry practices (such as overcrowding,
weaning time, transport to other facilities, mixing animals from
different origins, and coexistence of generational strata) [2, 3, 4, 5, 6].
In the state of Veracruz, there is a lack of information related to
the surveillance and molecular typing of microorganisms causing
ORS in sheep ocks. For this reason, the aim of the present study
was to identify the causal agents of an outbreak of ORS in a sheep
production unit in Northern Veracruz, Mexico. By isolating and
molecularly characterizing the pathogens involved, this research
aims to contribute to a better understanding of the epidemiology and
management of respiratory diseases in sheep populations.
MATERIAL AND METHODS
Sampling
The study was conducted in a sheep production unit located in the
municipality of Tihuatlan, Veracruz, within the Huasteca Baja region
of Northern Veracruz. The municipality’s geographical coordinates
are 20°43'1" N, 97°32'13" W, and it is situated at an altitude of 105
MASL. Median temperature is 30.7°C, relative humidity about 63–65%,
and precipitation of 15.8–16.0 mm. The production unit comprises
approximately 500 hair sheep.
Study population
In May 2022, lambs and adult animals in the production unit
exhibited respiratory signs such as expectoration, rhinorrhoea,
lethargy, and loss of appetite. These symptoms were accompanied by
an alarming increase in mortality rates among the sheep. In response
to the situation, animals showing signs of illness were quarantined,
and further investigation was initiated to identify potential causal
agents. A total of 30 sheep were sampled, 22 were females and
8 males, with ages ranging from one month to two years, with an
average of 1.5 years.
During the investigation, sheep were physically restrained, and
demographic data along with physiological constants (temperature,
respiratory rate and heart rate) of each animal were recorded. After
physical restraint, the exterior of the nose of each animal was
disinfected with Mycrodacyn, and a sterile Dacron®/polyester swab
was inserted into the nostril and rotated against the wall of the nasal
cavity. Nasal swab samples were collected from the affected animals
and preserved in 15 mL conical tubes containing sterile saline to
conserve bacterial and mycotic agents. Subsequently, the samples
were maintained in a cold chain to preserve their integrity until their
arrival at the laboratory for analysis.
Bacterial and mycotic isolation
Samples taken individually streaking nasal swab were inoculated
directly onto selective agar media (MacConkey and blood agar for
bacterial isolation, and Sabouraud Dextrose Agar, Emmons with
Gentamicin for fungal isolation) which were incubated (Ecoshel,
91210, Pharr, USA) at 37°C for 72 hours (h) and checked every 12 h for
the presence of microbial growth.
Molecular identication of bacterial isolates
On each solid culture plate with growth, several colonies of interest
(with similar morphology, size and coloration) were selected for DNA
extraction. They were placed with the help of a microbiological loop
in 1.5 mL low–adherence conical tubes (LoBbind). For each tube
we added 500 µL of a 10% Chelex 100 chelating resin solution (Bio–
Rad®, United States of America (USA) with 20 µL of proteinase K
(SIGMA life sciences®, USA) and incubated at 56°C for one hour (IVYX
Scientic, 0745556232573, Washington, USA). Subsequently, the
temperature was increased to 94°C for 15 min to denature excess
of proteins and were centrifuged at 8,000 G (Hsiang Tai Model
CN–3600, Taiwan, China) for 15 min. Samples were allowed to cool
to room temperature, supernatant were recovered in new tubes and
then frozen at -20°C until use (Hisense®, FC88D6BWX1, China). A
450 bp fragment of the 16S ribosomal gene was amplied in a Veriti
96–Well Fast Thermal Cycler (ThermoFisher Scientic, 4375305,
Massachusetts,USA). The reaction mix consisted of 12.5 µL of GoTaq®
Green Master Mix, 2× Promega Corporation (Madison, WI, USA), 1µL
of each oligonucleotide (EHR01 GCCTAACACATGCAAGTCGAACG
and EHR02 GCCCAATAATTCCGAACAACG) [7], 1 µL of DNA (50 ng)
and 9.5 µL of nuclease–free water. We followed the thermal PCR
conditions previously proposed [7]. PCR products were visualized
by electrophoresis (Shelton Scientic®, QS–710, EUA) in 2% agarose
gels stained with Midori green and run with 1% TAE running buffer
solution at 85V for 40 min. Positive amplicons were sent for
sequencing (Applied BiosystemsTM, 3130xl, EUA) to Macrogen, Korea.
The sequences obtained in this study were aligned with those of
other validated bacterial species from the same genera deposited
in GenBank using the Clustal W algorithm in MEGA 10. We selected
the nucleotide substitution model based on the lowest AICc (Akaike
information criterion, corrected). A phylogenetic reconstruction was
generated using Maximum Likelihood, with 1000 Bootstrap replicates,
using the close neighbour interchange method. Gaps were excluded
from the analysis.
RESULTS AND DISCUSSION
The physiological constants recorded in the 30 sampled animals
were as follows: Temperature 39.84 ± 0.75 (39–41) °C, respiratory
rate 17.84 ± 2.95 (14–24) BPM, and heart rate 82.68 ± 9.38 (70–97)
BPM. A total of 22 positive culture media for bacterial growth were
FIGURE 1. Maximum likelihood phylogenetic tree generated using T93 + G+I
distance model with partial sequences of the 16S rRNA gene from several members
of the genus Enterobacter. Bootstrap values greater than 50 are indicated at the
nodes. Sequences generated in this study are marked with solid forms
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34485
3 of 5
obtained, which described rounded, raised colonies with a pink
mucoid aspect. None of the Sabouraud media were positive for
fungal growth. All media with growth were tested for the detection
of bacterial using universal 16S rDNA primers. Males exhibited the
highest percentage of infection with an 87.5% (7/8), followed by
females with 68.18% (15/22), representing a frequence of 73.33%
(22/30). However, we only recovered 20 sequences with adequate
quality for phylogenetic analysis.
The set of 20 consensus sequences obtained had 490 bp, coverage
of 99–100%, and similarities ranging 99.59% with sequences of
Enterobacter hormaechei from China (GenBank Accession numbers
MN007139.1 and KJ660958.1). Sequences generated in this study
were deposited in GenBank under the following accession numbers:
PP893165–PP893184. The ML reconstruction grouped our sequences
in the same branch with other E. hormaechei sequences deposited
in GenBank supported by a bootstrap value of 63%. (FIG. 1).
Ovine respiratory syndrome is commonly attributed to bacterial
agents of the Pasteurella, Mannheimia, Bibersteinia, and Mycoplasma
genera, the inclusion of E. hormaechei among the bacterial agents
is notable [2, 4, 5, 6].
The identification of E. hormaechei in sheep with respiratory
problems marks a signicant discovery, particularly as it is the rst
report of this microorganism in ORS in Mexico and Latin America.
This suggests a potential emerging pathogen in sheep populations
in the region. E. hormaechei is a Gram–negative oxidase–negative,
fermentative bacterium and a member of the Enterobacter cloacae
complex (ECC), is primarily known for its significance in human
clinical settings, where it can cause serious nosocomial infections
[8]. Its presence in ORS adds a new dimension to our understanding
of respiratory diseases in ovine populations [4, 8]. The identication
of E. hormaechei expands this list and underscores the importance
of considering a broad range of potential pathogens in the diagnosis
and management of respiratory diseases in sheep.
This discovery highlights the need for further research into the
prevalence, transmission dynamics, and impact of E. hormaechei
on sheep health and production in Mexico and Latin America.
Understanding the role of this microorganism in ovine respiratory
diseases can inform preventive measures and treatment strategies
to better protect sheep populations and enhance overall herd health.
The expanding recognition of E. hormaechei as a potential pathogen
in various animal species accentuates its importance in veterinary
medicine and highlights the need for increased awareness and
surveillance of this microorganism. Reports of E. hormaechei in
different animal species, including pigs, foxes, and cattle, suggest
its ability to infect a wide range of hosts and potentially cause
various clinical conditions, from diarrhoea in piglets to severe
respiratory conditions in calves [9, 10, 11]. The recent identication
of E.hormaechei as the causative agent of fatal respiratory conditions
in calves and lambs in China emphasizes the significance of
understanding its role in animal health and disease [8, 9, 10].
Recently, the isolation of E. hormaechei from lung tissue samples of
sheep, as well as its genetic similarity to strains from cattle, suggests
a possible cross–species transmission route which is strengthened
by the ndings of the present study [8, 9, 10]. In the context of the
farm studied in the present study, where dual–purpose cattle are
present, but no effective preventive medicine program is in place,
the lack of biosecurity measures such as sanitary mats or controlled
movement between cattle grazing sites and sheep sheds may
facilitate transmission, potentially through fomites. The observation
of a high number of animals per square meter, experiencing rapidly
evolving respiratory problems leading to increased mortality suggests
a signicant health challenge within the sheep population on the
analysed farm. Several factors may contribute to this situation, like
immunosuppression triggered by seasonal changes and decreasing
temperatures [4, 5, 6]. Respiratory diseases in sheep are often
exacerbated during periods of environmental stress, such as seasonal
transitions, which can weaken the animals’ immune system and
increase their susceptibility to infections [4, 6].
Multiple reports of resistance to a wide range of antibiotic therapies
by this species of Enterobacter exist [11, 12, 13], particularly to β–
lactam and quinolone, which are widely used in the human clinic,
which is why this species must be approached from the perspective
of comprehensive perspective of One Health to reduce the risk of
circulation between species and establishment in humans [10, 12, 13].
Despite regular treatment with enrooxacin in animals from the
studied farm, the persistence of respiratory problems suggests a
potential issue with treatment ecacy. The literature indicates that
resistance to quinolones, including enrooxacin, is a growing concern
in veterinary medicine, with many strains of bacteria exhibiting
resistance to these antibiotics [12, 13].
Isolation and molecular identification of Enterobacter hormaechei in sheep / Huerta–Peña et al. ___________________________________
4 of 5
In this study, the lack of establishment of an antibiotic susceptibility
profile for the recovered colonies hinders the ability to identify
potential antibiotic resistance. Understanding the susceptibility
of bacterial isolates to antibiotics is crucial for guiding appropriate
treatment strategies and preventing the spread of resistant strains.
Moving forward, it is essential to conduct a comprehensive
antibiotic susceptibility testing on bacterial isolates from affected
animals to determine the most effective treatment options.
Additionally, apply strategies to minimize the risk of antibiotic
resistance, such as prudent antibiotic use, surveillance of resistance
patterns, and implementation of infection control practices, is crucial
for maintaining animal health and welfare on the farm.
CONCLUSIONS
In this work, the presence of E. hormaechei with a frequence
of 73.33% was detected for the rst time through microbiological
isolation and molecular typing in sheep with respiratory symptoms
in a livestock farm in the North of Veracruz, which suggests that
these bacteria must be monitored as a possible causal agent of ORS
in Mexico and other Latin American countries. Continued research is
essential to explore the prevalence, impact, and control strategies
for E. hormaechei and other pathogens in sheep populations.
ACKNOWLEDGMENTS
We thank the local producers for their collaboration to get this
study completed. We are grateful to the undergraduate students
of the Veterinary Medicine program for their support to accomplish
this study.
Declaration of competing interest
The authors declare that they have no known competing nancial
interests or personal relationships that could have appeared to
inuence the work reported in this paper.
Funding
Not applicable.
Ethical approval
The authors conrm that the ethical policies of the journal, as noted
on the journal’s author guidelines page, have been adhered to. This
study was approved by the Bioethics Committee of the Facultad de
Ciencias Biológicas y Agropecuarias, Campus Poza Rica–Tuxpan of
the Universidad Veracruzana (UV) (Animals were handled according
to National Legislation and Ethics (NOM–012–ZOO–1993).
Data availability
All datasets used and/or analyzed during this study are included in
this article. Sequences generated are deposited in GenBank under
Accession numbers: PP893165–PP893184.
Consent to participate
Not applicable
Consent for publication
Not applicable
Author contributions
Javier C. Huerta–Peña: Conceptualization, Data curation, Investigation,
Methodology, Writing – original draft. Gabriela R. Hernández–Carbajal:
Conceptualization, Data curation, Investigation, Methodology, Writing –
original draft. Gerardo G. Ballados–González: Investigation, Supervision,
Writing – original draft, Writing – review and editing. José M. Martínez–
Hernández: Investigation, Supervision, Writing – original draft, Writing –
review and editing. José A. Villagómez–Cortés: Investigation, Supervision,
Writing – original draft, Writing – review and editing. Sokani Sánchez–
Montes: Conceptualization, Data curation, Formal analysis, Funding
acquisition, Investigation, Project administration, Writing – original
draft, and Writing – review and editing.
BIBLIOGRAPHIC REFERENCES
[1] Instituto Nacional de Estadística y Geografía (INEGI). Censo
agropecuario 2022. [Internet]. Mexico city: Instituto Nacional
de Estadística y Geografía; 2023 [cited 26 May 2024]. Available
in: https://goo.su/z3xH8
[2] Chakraborty S, Kumar A, Tiwari R, Rahal A, Malik Y, Dhama K, Pal
A, Prasad M. Advances in diagnosis of respiratory diseases of
small ruminants. Vet. Med. Int. [Internet]. 2014; 2014:508304.
doi: https://doi.org/gb55x4
[3] Kappes A, Tozooneyi T, Shaki, G, Railey AF, McIntyre KM, Mayberry
DE, Rushton J, Pendell DL, Marsh TL. Livestock health and disease
economics: a scoping review of selected literature. Front. Vet.
Sci. [Internet]. 2023; 10:1168649. doi: https://doi.org/g8t6k5
[4] Navarro T, Ramos JJ, Ruíz de Arcaute M, González JM.
Predisposing factors inducing ovine respiratory complex in
intensive–reared lambs. Small Rumin. Res. [Internet]. 2019;
180(6):106–111. doi: https://doi.org/g8t6k6
[5] Pan H, Jiao Z, Li H, Li S, Xu L, Li S, Meng Y, Fu Y, Chen T, Chen Q,
Chen S, Du L, Man C, Wang F, Gao H. Sheep and goat pathogen
database: a pathogen data integration and analysis database of
sheep and goat infectious diseases. Front. Microbiol. [Internet].
2024; 14:1299303. doi: https://doi.org/g8t6k7
[6] Scott PR. Treatment and control of respiratory disease in sheep.
Vet. Clin. North Am. Food Anim. Pract. [Internet]. 2011; 27(1):175–
186. doi: https://doi.org/cbmjwn
[7] Murphy DS, Lee X, Larson SR, Johnson DK, Loo T, Paskewitz SM.
Prevalence and distribution of human and tick infections with
the Ehrlichia muris–like agent and Anaplasma phagocytophilum
in Wisconsin, 2009–2015. Vector Borne Zoonotic. Dis. [Internet].
2017; 17(4):229–236. doi: https://doi.org/f93kzj
[8] Shi H, Wang K, Wang L, Sun S, Li B, Yao L. Case report of Enterobacter
hormaechei in sheep with respiratory disease and death. BMC Vet.
Res. [Internet]. 2022; 18(1):57. doi: https://doi.org/g8t6k8
[9] Wang Z, Duan L, Liu F, Hu Y, Leng C, Kan Y, Yao L, Shi H. First
report of Enterobacter hormaechei with respiratory disease in
calves. BMC Vet. Res. [Internet]. 2020; 16(1):1. doi: https://doi.
org/gq5crt
[10] Zaitsev SS, Khizhnyakova MA, Feodorova VA. First case report
of detection of multidrug–resistant Enterobacter hormaechei
in clinical sample from an aborted ruminant. Microorganisms
[Internet]. 2022; 10(5):1036. doi: https://doi.org/g8t6k9
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34485
5 of 5
[11] Shan–Shan W, Yun–Jia S, Xing–Yang C, Cheng–Wei W, Shan–
Shan GU, Xin Y, Shuang X, Jun–Wei GE, Hong–Yan C. Isolation,
identification, and phylogenetic analysis of Enterobacter
hormaechei from foxes. Chinese Vet. Sci. 2017; 47(6):768–772.
[12] Khalifa HO, Oreiby A, Abd–El–Hafeez AA, Abd–El Latif A, Okanda T,
Kato Y, Matsumoto T. High β–lactam and quinolone resistance of
enterobacteriaceae from the respiratory tract of sheep and goat
with respiratory disease. Animals [Internet]. 2021; 11(8):2258.
doi: https://doi.org/g8t6mb
[13] Yeh TK, Lin HJ, Liu PY, Wang JH, Hsueh PR. Antibiotic resistance
in Enterobacter hormaechei. Int. J. Antimicrob. Agents [Internet].
2022; 60(4): 106650. doi: https://doi.org/g8t6mc
