https://doi.org/10.52973/rcfcv-e34425
Received: 25/03/2024 Accepted: 16/05/2024 Published: 08/08/2024
1 of 7
Revista Científica, FCV-LUZ / Vol. XXXIV, rcfcv-e34425
ABSTRACT
The genus Parapoxvirus of the family Poxviridae is the causative agent
of the Ecthyma Contagiosum (Orf virus) disease, which is widespread
in sheep and goats around the world. The Orf virus is also recognized
as an occupational zoonotic agent, causing auto limited lesions in
humans. The Orf virus has an anity for epithelial tissue and causes
proliferative lesions around the lips and nose, udder, and hairless areas
of the skin. In this study, the positivity of the virus was investigated by
PCR in samples collected from several provinces in different regions
of eastern and western Türkiye. Molecular characterization of the
samples identied as positive by PCR was performed based on the B2L
gene region. A phylogenetic tree was constructed by comparing the
obtained partial B2L gene sequences with the reference parapoxvirus
strains obtained from GenBank. It was found that the strains obtained
in the study were close to Iranian and Sudanese strains. When the
deduced amino acid sequences of the strains obtained with the
reference strains taken from GenBank were compared, amino acid
changes were detected at two different points. The phylogenetic
map showed that different variants were likely to have circulated
in different parts of the country. This study provided up–to–date
information on Orf virus strains circulating in different regions of
the country.
Key words: Ectima contagiosum, molecular characterization, Orf,
Parapoxviruses, phylogenetic analysis
RESUMEN
El género Parapoxvirus de la familia Poxviridae es el agente causante
de la enfermedad Ecthyma Contagiosum (virus Orf), que está muy
extendida entre ovejas y cabras en todo el mundo. El virus Orf tambien
es reconocido como un agente zoonótico ocupacional que causa
lesiones autolimitadas en humanos. El virus Orf tiene anidad por
el tejido epitelial y causa lesiones proliferativas alrededor de los
labios y la nariz, la ubre y las áreas desprovista de pelo en la piel. En
este estudio, se investigó la positividad del virus mediante PCR en
muestras recolectadas de varias provincias en diferentes regiones
del este y oeste de Turquia. La caracterización molecular de las
muestras identicadas como positivas mediante PCR se realizó
en base a la región del gen B2L. Se construyó un árbol logenético
comparando las secuencias parciales del gen B2L obtenidas con
las cepas de parapoxvirus de referencia obtenidas de GenBank. Se
encontró que las cepas obtenidas en el estudio eran similares a las
cepas iraníes y Sudanesas. Cuando se compararon las secuencias
de aminoácidos de las cepas obtenidas con las cepas de referencia
tomadas del GenBank, se detectaron cambios de aminoácidos en dos
puntos diferentes. El mapa logenético mostró que probablemente
habrían circulado distintas variantes en diferentes partes del país.
Este estudio proporcionó información actualizada sobre las cepas
del virus Orf que circulan en diferentes regiones del país.
Palabras clave: Ectima contagiosa, caracterización molecular, Orf,
Parapoxvirus, análisis logenético
Molecular characterization of ovine parapoxviruses in Türkiye:
phylogenetic overview
Caracterización molecular de parapoxvirus ovinos en Türkiye: descripción logenética
Zeynep Karapinar
1
* , Murad Gürses
2
1
Balıkesir University, Faculty of Veterinary Medicine, Department of Virology. Balikesir, Türkiye.
2
Balıkesir University, Faculty of Veterinary Medicine, Department of Genetics. Balikesir, Türkiye.
*Corresponding author: zeynepkarapinar@gmail.com
Molecular characterization of ovine parapoxviruses / Karapinar and Gürses ________________________________________________________
2 of 7
INTRODUCTION
Ectima contagiosum infection, also known as “Orf”, is an infection
of wild and domestic animals {primarily sheep and goats, but also
camels (Camelus bactrianus), deer (Cervus elaphus), dogs (Canis lupus
familiaris), cats (Felis catus), and squirrels (Sciurus Vulgaris)} caused
by the genus Parapoxvirus in the subfamily Chordopoxvirinae of the
family Poxviridae, which presents with non–systemic skin lesions [1].
The parapoxvirus genus also includes bovine pseudocowpox virus
(PCPV), papular stomatitis virus (BPSV), squirrel parapoxvirus (SPPV),
and New Zealand deer parapoxvirus [2, 3]. Infections caused by
parapoxviruses, which have a broad host spectrum, have also been
reported in several pinniped species, including seals [4]. The pathogen,
which has an epitheliotropic character, causes proliferative lesions
on the skin. Skin lesions of an edematous proliferative nature occur
around the lips and nose, on the udder and on hairless areas of the
skin and are generally much more severe in goats than in sheep [5].
ORFV is endemic throughout the world and has highly variable
virulence for a variety of hosts, including sheep, goats, dogs and
humans. Among small ruminants, ecthyma contagiosum is one of the
most prevalent skin diseases. This disease has a very high morbidity
rate in sheep and goats, which results in severe productivity losses
[6]. In addition, this infection causes signicant productivity losses in
the sheep industry, particularly lamb mortality [7]. Direct or indirect
contact with infected materials can spread the disease. Of course,
re–infection can occur months later in animals that have recovered
from the infection or have been vaccinated. Lesions on the tongue
and gums of affected animals may rarely occur in internal organs
[6, 8]. Young animals have been reported to be more susceptible to
infection than adults. While the morbidity of the disease is 100%,
the mortality can reach 15%, especially in young animals, due to
malnutrition, immunosuppression and secondary infections. The virus
is transmitted directly and indirectly between animals. In addition,
mortality increases in lambs and kid goats during the lactation period
due to dehydration and starvation as pain and deformities of the lips
and mouth reduce suckling [9, 10, 11]. As a consequence, production
decreases drive serious economic impact [7].
Particularly in the spring months, which include the lambing and
shearing periods, it has been reported that there is an increased
spread and risk of infection for those in close contact with animals,
such as veterinarians and farmers [12]. The zoonotic virus creates
lesions in humans which appear as painful, big nodules on the hands
and face [6, 13, 14]. The zoonotic infection is transmitted to humans
through contact with infected animals and causes lesions on the
hands, ngers, and rarely the face [15, 16, 17, 18].
The Orf virus (ORFV) genome consists of double–stranded linear
DNA, approximately 138 kb–140 kb in size, has a high GC content of
approximately 63.5%, and encodes 132 genes. It is known that 88 of
these genes are protected in PPVs (Parapoxviruses) [19]. Centrally
placed, relatively conserved genes are necessary for both viral
morphology and replication. While genes necessary for virulence,
pathogenesis and immune regulation are found in more variable
terminal portions of the genome, highly conserved genes involved
in viral replication and structure development can be found in the
central region [6, 20, 21].
PPVs are among the smallest of the genera in the subfamily
Chordopoxvirinae (approximately 260 nm in length), and although their
genome is similar to other genera, they have signicant differences
from other genera due to variations in the G+C content, virion shape,
and the existence of a sizable number of PPV–specic genes [22]. The
B2L gene (~1137 bp), the major envelope gene of the ORFV, encodes
an important immunogenic protein that elicits a strong antibody
response. The major envelope protein is encoded by the virus’s
envelope gene (B2L), which is a highly immunogenic protein with a
molecular weight of 42 kD [23]. Due this gene is highly conserved it
is often used for detection and genetic characterization of the virus
by molecular methods [9, 11, 23, 24].
Although clinical ndings are critical to the diagnosis of infection,
laboratory diagnosis is important because the symptoms can be
confused with infections such as the bluetongue virus, sheep pox
virus, foot–and–mouth disease, and type 2 bovine herpesvirus [25,
26]. Because molecular techniques are faster and more sensitive,
they are preferred to other techniques (virus isolation, histopathology,
etc.) in the diagnosis of the virus, and PCR is a specic method that
is widely used in the diagnosis and molecular characterization of
infection [23, 27, 28, 29].
The aim of this study was to perform molecular characterization
of the virus in crust samples collected from several provinces in the
eastern and western regions of Türkiye.
MATERIAL AND METHODS
Ethical statement
The Balikesir University Animal Experiments Local Ethics Committee
provided ethical approval for this investigation, which was carried out
with their consent dated 07/09/2023 and numbered 2023/7–4.
Animal and sample collection
The research material consisted of crust samples collected between
October and December 2023 from sheep (Ovis aries) in Balıkesir (4
samples), Tunceli (7 samples) and Bitlis (6 samples) provinces with
suspected Ectima Contagiosum infection. For laboratory studies,
dried skin crust samples were transferred to sterile tubes containing
2 mL transport medium–PBS. The tubes were vortexed, homogenized,
and centrifuged (Espresso–11210801, Thermo Scientic, China) at
1610 G for 10 min. The upper supernatant was transferred to 2.5 mL
storage tubes and prepared for viral DNA extraction. Samples were
stored at -20°C until assayed.
DNA extraction and Polymerase Chain Reaction (PCR)
Using a commercially available viral nucleic acid isolation kit
(Jena Bioscience, Viral RNA+DNA Preparation Kit, Germany),
viral DNA was extracted from samples in accordance with the
kit’s instructions. The resulting templates were stored at -20°C
(Hotpoint–Ariston ENTM 18211 F (TK), Italy) until PCR studies were
performed. Primers specic for the B2L gene region of Orf virus
were used for PCR [30]. For this purpose, the rapid PCR reaction
was performed with PPP1 (5’–GTCGTCCACGATGAGCAGCT–3’) and
PPP4 (5’–TACGTGGGAAGCGCCTCGCT–3’) primers. The result of this
reaction was a 594 bp product. A total of 30 µl PCR master mix was
prepared containing 3 µL DNA, 20 mM NH
4
(SO
4
)
2
, 75 mM Tris–HCl
(pH 8.8), 1.5 mM MgCl
2
, 10 pmol primers, 0.2 mM dNTP´s and Taq DNA
polymerase was prepared at 0.5 U (MBI, Fermentas, Lithuania). The
following heating programs were used in the thermal cycler (Prima–
Trio, Himedia, India) 9 min at 95°C, followed by 1 min at 94°C, 1 min
FIGURE 1. PCR amplication products using Orf virus primers. Lane M: 100–
bp DNA ladder marker (Fermentas); lanes 2,4,5,6,7,8,10,11,15,16,17: positive
amplication PCR products; lane 18: negative control (distilled water); lanes
1,3,9,12,13,14: negative amplication PCR product
TABLE I
Province, strain ID, GenBank accession numbers
of samples infected with ORFV
No Province Strain ID Accession No
1
Tunceli TR/ORFV02/TUN/2023 PP317136
2
Tunceli TR/ORFV04/TUN/2023 PP317137
3
Tunceli TR/ORFV05/TUN/2023 PP317138
4
Bitlis TR/ORFV06/BIT/2023 PP317139
5
Balıkesir TR/ORFV08/BAL/2023 PP317140
6
Bitlis TR/ORFV16/BIT/2023 PP317141
7
Bitlis TR/ORFV/17/BIT/2023 PP317142
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34425
3 of 7
at 55°C and 1 min at 72°C, a nal extension was performed at 72°C
during 10 min. DNA products were analysed by a GelRed stained 1%
agarose gel electrophoresis. Amplied products were visualized
under UV light (MaestroGen UltraBright® UV Transilluminator MB–21,
Taiwan) on a gel imaging device.
Sequencing and Phylogenetic Analysis
Strong positive amplified PCR products were chosen for
sequencing. DNA was puried using a commercial purication kit,
and then sequenced using the Sanger method with the primers used
in the PCR procedure. For this purpose, the capillary was subjected to
electrophoretic separation (Nanopac–300, Fisher Scientic,England)
in a specialized laboratory (Eurons Laboratory, Germany).
This gene region is highly conserved and has been widely used in
molecular detection and genetic characterization of species within
the parapoxvirus genus [6, 24]. In this study, this gene region was
selected for genetic characterization of the virus.
The sequences obtained were manually veried by visual analysis of
the electrophoregram using Bioedit version.7.0.5.3 software [31] and
compared with the GenBank database using the NCBI Blast search
tool. All sequences were aligned using the MUSCLE algorithm [32],
with sequences trimmed at the start and end positions after alignment
in MEGA–X. (Molecular Evolutionary Genetic Analysis, version 10.2.6)
[33]. Phylogenetic trees were constructed using maximum likelihood
methods, with bootstrap analysis based on 1000 replicates. Based on
the ndings of the investigation for MEGA X’s best DNA/protein model
features, the phylogenetic analysis models were chosen. Using the
Tamura 3–parameter model with gamma distribution, the maximum
likelihood (ML) approach was applied to create phylogenetic trees
(T92+G) [34]. Phylogeny was tested by 1000 bootstrap replicates.
Interactive Tree of Life (iTool) was used to generate a circular
phylogenetic tree diagram [35].
RESULTS AND DISCUSSIONS
In this study, PCR was used for virus detection. In the study, 12 of the
samples collected from 17 sheep showing clinical signs of infection
were found to be positive (FIG. 1).
Electrophoretic bands of expected size (594bp) were visualized.
Since sequence analysis was performed in the study and the data
obtained were revealed by phylogenetic analysis, no positive control
was used. Sequence analysis was performed on 7 of the samples
from different regions.
The samples evaluated after sequence analysis were registered
in GenBank and accession numbers were obtained. Sequences that
were listed in the GenBank nucleotide sequence database provided
the data for the phylogenetic analysis (TABLE I).
A phylogenetic tree was created by comparing the partial B2L
gene sequences obtained from the GeneBank with the sequences
obtained in our study (FIG. 2). Three of the ORFV sequences obtained
in the study (Acces. Num. PP317136, PP317137, PP317138) showed high
similarity to each other (from Tunceli), while the other three (Acces.
Num. PP317139, PP317141, PP317142) showed high similarity to each
other (from Bitlis). Sequence PP317140 (from Balıkesir) was found to
be on a separate branch and close to the second three sequences.
The mean genetic distance in pairwise analysis was calculated to be
0.015. The genetic distance between PP317136, PP317137, PP317138
and PP317139, PP317141, PP317142 was 0.015. The genetic distance
between PP317140 and PP317139, PP317141, PP317142 was 0.003. The
maximum genetic distance was observed between PP317140 and
PP317136, PP317137, PP317138 with 0.019.
ORFV is endemic in all regions of Türkiye, especially in sheep and goat
herds [23, 24, 27, 36]. When all previously reported ORFV sequences in
Turkey are examined, it is found that they show great diversity among
themselves and are distributed in different clusters. The partial B2L
sequences obtained in our study were found to be far away from the
previous Turkish sequences in the phylogenetic tree. The disease
has a worldwide distribution and has been reported in China [37],
Ethiopia [38], South Korea [39], Egypt [40], India [41], Greece [12],
Finland [42], Sudan [43], Nigeria [44] and USA [45]. In the worldwide
search, there are many strains recorded in GenBank. It was found
that the strains obtained in the study were more similar to Iranian
and Sudanese strains. While the genetic distance between strains
PP317136, PP317137, PP317138 and AY958203 (Iranian strain) was 0.007,
the genetic distance between them and MN701771 (Sudanese strain)
was determined to be 0.015. On the other hand, the genetic distance
between strain PP317140 and both strains AY958203 (Iran strain) and
MN701771 (Sudan strain) was determined to be 0.011. Strains PP317139,
PP317141, PP317142 were found to be similar to strain KX013765 (Turkey–
Van strain) previously identied in Türkiye, and the genetic distance
between them was determined to be 0.003. Considering that these
strains were obtained from Bitlis province, the geographical proximity
between Bitlis and Van provinces explains this similarity.
FIGURE 3. Comparison of amino acid sequences of the strains obtained from the study with reference strains
FIGURE 2. Phylogenetic analysis of the ORFV B2L gene
Molecular characterization of ovine parapoxviruses / Karapinar and Gürses ________________________________________________________
4 of 7
FIGURE 4. The place of our strains in the genus Parapoxvirus. Strains from our
study are marked with a square
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34425
5 of 7
The amino acid sequences of the strains obtained from the study
were compared with the reference strains [6, 46] from GenBank
determined in the partial B2L gene of the ORFV genome and amino acid
changes were detected at two different points (FIG. 3). Valine (val–V) was
shown to be transformed to Isoleucine (ile–I) at amino acid position 25
in Fig 3. (185th amino acid position in the B2L gene sequence) in every
strain. Furthermore, it was found that in the PP317137 and PP317138
strains, Aspartic acid (asp–D) replaced Asparagine (asn–N) at amino acid
position 134 in Fig. 3 (294th in the B2L gene sequence). It was noted
that this change was also present in the DQ904351 (Taiwan) reference
strain. The B2L gene encodes immunogenic proteins expressed on
extracellular enveloped virions and is translated late in the infection
process. The B2L gene is a palmitoylated protein that is crucial for
the viral envelope and is one of the main antigens on the surface of
enveloped virions. Because of its various roles in the host environment,
it is also one of the primary envelope proteins that the host animals
(goats and sheep) generate an effective immune response against [47].
It has been used in phylogenetic research aimed at the evolutionary
and genetic connections between parapoxvirus genus outbreaks in
various animals [6, 24]. In the study, limited mutations and amino acid
changes were detected on this gene. Nonetheless, no distinct changes
of amino acids were detected, which could indicate that the strains of
ORFV are closely linked antigenically. Although the B2L gene is a highly
conserved gene, it encodes a highly immunogenic protein. It has also
been reported that unique host–specic residues identied in the
B2L protein contribute to determining the host range [41]. Therefore,
it is thought that signicant mutations that may occur in the gene
may affect the host spectrum of the virus, its pathogenicity and the
effectiveness of vaccines.
The place of the strains obtained in our study among the parapoxviruses
was shown by constructing a separate phylogenetic tree (FIG. 4).
This study aimed to perform the molecular characterization of the
Orf virus. Typing the resulting strains and classifying parapoxviruses
into different types, including BPSV, PCPV, ORFV and others, is possible
with molecular methods and genetic analysis. In addition, natural host
range, clinical symptoms and serological ndings are also used in the
classication of parapoxviruses [26]. Genetic studies on the B2L gene
of ORFV, BPSV and PCPV have shown that this gene is a well–conserved
gene region. It has been determined that the central region of the gene
is better protected than the terminal regions [6]. By building a distinct
phylogenetic tree, the position of the strains found in our investigation
within the parapoxvirus family was displayed. It was found that all of
these strains are ovine parapoxviruses as it was shown in FIG. 2.
Previous studies have shown that the rate of mutation accumulation
in poxviruses varies signicantly between different poxvirus genera and
strains. Parapoxviruses have a high GC content (64.0–64.5%) in their
genomic DNA, in contrast to the low GC content of other poxvirus genera
(25.0–43.6%). Low and high GC ratios have been used to differentiate
poxviruses, and PCR techniques need to be modied depending on
whether this ratio is high or low [45]. Although parapoxvirus is a DNA
virus, mutations and changes can occur and this situation results in the
occurrence of new gene structure and new virus strains. In addition,
it has been reported that the reason for the failure of vaccines may
be related to the long–term adaptation of the virus to tissue culture
and that the recombinant DNA vaccines developed are more effective
[48]. Newly discovered strains will provide progress in producing new
vaccines and preventing epidemics.
CONCLUSIONS
In the study, molecular characterization based on the B2L
gene region of ORFV strains obtained from different regions was
performed, and up–to–date information was obtained by revealing
their genetic relationships with other parapoxviruses. As a result
of the phylogenetic analysis obtained as a result of the study, it is
noteworthy that strains originating from different geographies are
in circulation in Türkiye. In the study, strains were obtained from the
eastern and western regions of country and were found to be close
to eastern strains. The importance of animal mobility and Türkiye’s
intercontinental geographical location should be taken into account
in the spread of many animal diseases, including ORFV infection,
which is important for livestock
In several countries, ORFV infection is an economically serious
problem for the commercial breeding of sheep and goats. To date,
various strategies have been investigated to develop effective antiviral
drugs and prophylactic vaccines to control ORFV infection, most of
which are derived from immunogenic envelope proteins. It should
be taken into consideration that periodic prevalence and current
molecular studies involving different gene regions to investigate this
disease of zoonotic importance will provide important information
for human and animal health and will contribute to the creation of
effective prevention and control programs regarding the disease.
Availability of data and materials
The data used and analysed in this study are available from the
corresponding author on reasonable request.
Molecular characterization of ovine parapoxviruses / Karapinar and Gürses ________________________________________________________
6 of 7
Funding support
There is no funding support for the study.
Conict of Interest
The authors declared that there is no conict of interest.
Author contributions
ZK performed the molecular analyses, MG contributed to the
sequence and phylogenetic analyses, ZK and MG drew the gures,
wrote and edited the manuscript. Both authors read and approved
the nal version of the manuscript.
BIBLIOGRAPHIC REFERENCES
[1] Hautaniemi M, Vaccari F, Scagliarini A, Laaksonen S, Huovilainen
A, McInnes CJ. Analysis of deletion within the reindeer
pseudocowpoxvirus genome. Virus Res. [Internet]. 2011; 160(1–
2):326–332. doi: https://doi.org/czdqc9
[2] Lojkic I, Cac Z, Beck A, Bedekovic T, Cvetnic Z, Sostaric B.
Phylogenetic analysis of Croatian Orf viruses isolated from sheep
and goats. Virol. J. [Internet]. 2010; 7:314. doi: https://doi.org/b7bt3n
[3] Kanou Y, Inoshima Y, Shibahara T, Ishikawa Y, Kadota K, Ohashi S,
Morioka K, Yoshida K, Yamada S. Isolation and characterization of
a parapoxvirus from sheep with papular stomatitis. Japan Agric.
Res. Q. [Internet]. 2005; 39(3):197–203. doi: https://doi.org/gt5cvd
[4] Guo J, Rasmussen J, Wünschmann A, De La Concha–Bermejillo
A. Genetic characterization of Orf viruses isolated from various
ruminant species of a Zoo. Vet. Microbiol. [Internet]. 2004;
99(2):81–92. doi: https://doi.org/dmqf6d
[5] Kumar R, Moudgil P, Grakh K, Jindal N, Sharma M, Gupta R.
Epidemiology, clinical features, and molecular detection of
Orf virus in Haryana (India) and its adjoining areas. Trop. Anim.
Health Prod. [Internet]. 2022; 54(5). doi: https://doi.org/gt5cvf
[6] Hosamani M, Bhanuprakash V, Scagliarini A, Singh RK. Comparative
sequence analysis of major envelope protein gene (B2L) of
Indian Orf viruses isolated from sheep and goats. Vet. Microbiol.
[Internet]. 2006; 116(4):317–324. doi: https://doi.org/c4w3z5
[7] Zhao K, Song D, He W, Lu H, Zhang B, Li C, Chen K, Gao F. Identication
and phylogenetic analysis of an Orf virus isolated from an outbreak in
sheep in the Jilin province of China. Vet. Microbiol. [Internet]. 2010;
142(3–4):408–415. doi: https://doi.org/cqt5r2
[8] Zheng W, Zhang Y, Gu Q, Liang Q, Long Y, Wu Q. Development
of an indirect ELISA against Orf virus using two recombinant
antigens , partial B2L and F1L. J. Virol. Methods [Internet]. 2024;
326:114891. doi: https://doi.org/gt5cvg
[9] Khalafalla AI, El–Sabagh IM, Al–Busada KA, Al–Mubarak AI, Ali
YH. Phylogenetic analysis of eight sudanese camel contagious
ecthyma viruses based on B2L gene sequence. Virol. J.
[Internet]. 2015; 12(1):1–9. doi: https://doi.org/f7mj7n
[10] Schmidt C, Cargnelutti JF, Brum MCS, Traesel CK, Weiblen R,
Flores EF. Partial sequence analysis of B2L gene of Brazilian Orf
viruses from sheep and goats. Vet. Microbiol. [Internet]. 2013;
162(1):245–253. doi: https://doi.org/gt5cvh
[11] Shehata AA, Elsheikh HA, Abd–Elfatah EB. Molecular detection
and characterization of Orf virus from goats in Egypt. Open Vet.
J. [Internet]. 2022; 12(2):273–280. doi: https://doi.org/gt5cvj
[12] Billinis C, Mavrogianni VS, Spyrou V, Fthenakis GC. Phylogenetic
analysis of strains of Orf virus isolated from two outbreaks of
the disease in sheep in Greece. Virol. J. [Internet]. 2012; 9:1–8.
doi: https://doi.org/fznz5j
[13] Karakas A, Oguzoglu TC, Coskun O, Artuk C, Mert G, Gul HC, Sener
K, Özkul A. First molecular characterization of a Turkish Orf virus
strain from a human based on a partial B2L sequence. Arch. Virol.
[Internet]. 2013; 158(5):1105–1108. doi: https://doi.org/f4tvsf
[14] Midilli K, Erkiliç A, Kuşkucu M, Analay H, Erkiliç S, Benzonana N,
Yildirim MS, Mülayim K, Acar H, Ergonul O. Nosocomial outbreak
of disseminated Orf infection in a burn unit, Gaziantep, Turkey,
October to December 2012. Eurosurveillance [Internet]. 2013;
18(11):1–5. doi: https://doi.org/gkmv8p
[15] Zhang K, Liu Y, Kong H, Shang Y, Liu X. Comparison and
phylogenetic analysis based on the B2L gene of Orf virus
from goats and sheep in China during 2009–2011. Arch. Virol.
[Internet]. 2014; 159(6):1475–1479. doi: https://doi.org/f55s7n
[16] Yeltekin AÇ, Karapinar Z, Mis L. The changes in the levels of
elements in sheep with Contagious Ecthyma. Indian J. Anim.
Res. [Internet]. 2018; 52(1):56–60. doi: https://doi.org/gt5cvk
[17] Milovanović M, Milićević V, Valčić M, Stević N, Nišavić J, Radojičić
S. Detection and phylogenetic analysis of B2L gene of ORF virus
from clinical cases of sheep in Serbia. Pak. Vet. J. [Internet].
2019; 39(3):433–437. doi: https://doi.org/gt5cvm
[18] Oğuzoğlu TÇ, Koç BT, Kirdeci A, Tan MT. Evidence of zoonotic
pseudocowpox virus infection from a cattle in Turkey. VirusDisease
[Internet]. 2014; 25(3):381–384. doi: https://doi.org/gt5cvn
[19] Li S, Jing T, Zhu F, Chen Y, Yao X, Tang X, Zuo C, Liu M, Xie Y, Jiang
Y, Wang Y, Li D, Li L, Gao S, Chen D, Zhao H, Ma W. Genetic Analysis
of Orf Virus (ORFV) Strains Isolated from Goats in China: Insights
into Epidemiological Characteristics and Evolutionary Patterns.
Virus Res. [Internet]. 2023; 334:199160. doi: https://doi.org/gt5cvp
[20] Chan KW, Yang CH, Lin JW, Wang HC, Lin FY, Kuo ST, Wong ML,
Hsu WL. Phylogenetic analysis of parapoxviruses and the C–
terminal heterogeneity of viral ATPase proteins. Gene [Internet].
2009; 432(1–2):44–53. https://doi.org/c4g3r2
[21] Coradduzza E, Scarpa F, Rocchigiani AM, Cacciotto C, Lostia G,
Fiori MS, Rodriguez Valera Y, De Pascali AM, Brandolini M, Azzena
I, Locci C, Casu M, Bechere R, Pintus D, Ligios C, Scagliarini A,
Sanna D, Puggioni G. The Global Evolutionary History of Orf Virus
in Sheep and Goats Revealed by Whole Genomes Data. Viruses
[Internet]. 2024; 16(1):158. https://doi.org/gt5cvq
[22] Peralta A, Robles CA, Micheluod JF, Rossanigo CE, Martinez A,
Carosio A, König GA. Phylogenetic analysis of ORF viruses from
ve contagious Ecthyma outbreaks in Argentinian goats. Front.
Vet. Sci. [Internet]. 2018; 5:9–11. doi: https://doi.org/gt5cvr
[23] Kaplan M, Koç B, Pekmez K, Çağırgan A, Arslan F. Updated
Molecular Characterization of Orf Virus in Türkiye. Kocatepe Vet.
J. [Internet]. 2023 [cited 25 Feb 2024]; 16(3):375–382. Available
in: https://goo.su/UkYKI
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34425
7 of 7
[24] Şevik M. Association of two clusters of Orf virus isolates in
outbreaks of infection in goat in the Central Anatolian region
of Turkey. VirusDisease. [Internet]. 2017; 28(3):345–348. doi:
https://doi.org/gt5cvs
[25] Inoshima Y, Murakami K, Wu D, Sentsui H. Characterization
of parapoxviruses circulating among wild Japanese serows
(Capricornis crispus). Microbiol. Immunol. [Internet]. 2002;
46(8):583–587. doi: https://doi.org/gt5cvt
[26] Timurkan MO, Kirbas A, Aydin H, Yanar KE, Aydin O. First
molecular characterization of bovine papular stomatitis virus
and meta–analysis of parapoxviruses in Turkey. Isr. J. Vet. Med.
[Internet]. 2021 [cited 25 Feb 2024]; 76(2):55–62. Available in:
https://goo.su/nEgbB
[27] Akkutay–Yoldar Z, Oguzoglu TC, Akça Y. Diagnosis and
phylogenetic analysis of Orf virus in Aleppo and Saanen goats
from an outbreak in Turkey. Virol. Sin. [Internet]. 2016; 31(3):270–
273. doi: https://doi.org/gt5cvv
[28] Şevik M. Orf virus circulation in cattle in Turkey. Comp. Immunol.
Microbiol. Infect. Dis. [Internet]. 2019; 65:1–6. doi: https://doi.
org/gt5cvw
[29] Pang F, Long Q. Recent advances in diagnostic approaches for Orf
virus. Appl. Microbiol. Biotechnol. [Internet]. 2023; 107(5–6):1515–
1523. doi: https://doi.org/gt5cvx
[30] Inoshima Y, Morooka A, Sentsui H. Detection and diagnosis of
parapoxvirus by the polymerase chain reaction. J. Virol. Methods
[Internet]. 2000; 84(2):201–208. doi: https://doi.org/ffxvgm
[31] Hall TA. BIOEDIT: A user–friendly biological sequence alignment
editor and analysis program for Windows 95/98/ NT. Nucleic
Acids Symp. Ser. 1999; 41(41):95–98.
[32] Edgar RC. MUSCLE: Multiple sequence alignment with high
accuracy and high throughput. Nucleic Acids Res. 2004;
32(5):1792–1797. doi: https://doi.org/dz84kz
[33] Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular
evolutionary genetics analysis across computing platforms.
Mol. Biol. Evol. [Internet]. 2018; 35(6):1547–1549. doi: https://
doi.org/gd39d8
[34] Tamura K. Estimation of the number of nucleotide substitutions
when there are strong transition–transversion and G+C–content
biases. Mol. Biol. Evol. 1992; 9(4):678–687. doi: https://doi.org/
ghwxzr
[35] Letunic I, Bork P. Interactive tree of life (iTOL) v5: An online tool
for phylogenetic tree display and annotation. Nucleic Acids Res.
[Internet]. 2021; 49(W1):W293–W296. doi: https://doi.org/3fm6
[36] Koç BT. Molecular evidence for concurrent infection of goats by
Orf virus and bovine herpesvirus 1. Acta Vet. Hung. [Internet].
2022; 70(2):156–161. doi: https://doi.org/gt5cvz
[37] Li H, Zhu X, Zheng Y, Wang S, Liu Z, Dou Y, Hui Li, Cai X, Luo X.
Phylogenetic analysis of two Chinese Orf virus isolates based on
sequences of B2L and VIR genes. Arch. Virol. [Internet]. 2013;
158(7):1477–1485. doi: https://doi.org/f43hnx
[38] Gelaye E, Achenbach JE, Jenberie S, Ayelet G, Belay A, Yami
M, Loitsch A, Grabherr R, Diallo A, Lamien CE. Molecular
characterization of Orf virus from sheep and goats in Ethiopia,
2008–2013. Virol. J. [Internet]. 2016; 13(1):1–12. doi: https://doi.
org/gt5cv2
[39] Oem JK, Chung JY, Kim YJ, Lee KK, Kim SH, Jung BY, Hyun BH.
Isolation and characterization of Orf viruses from korean black
goats. J. Vet. Sci. [Internet]. 2013; 14(2):227–230. doi: https://
doi.org/f4372d
[40] El–Tholoth M, Elnaker YF, Shiha G. Phylogenetic analysis of B2L gene
of Egyptian Orf virus from naturally infected sheep. VirusDisease
[Internet]. 2015; 26(3):147–150. doi: https://doi.org/gt5cv3
[41] Kumar N, Wadhwa A, Chaubey KK, Singh S V., Gupta S, Sharma
S, Sharma DK, Singh MK, Mishra AK. Isolation and phylogenetic
analysis of an Orf virus from sheep in Makhdoom, India. Virus
Genes [Internet]. 2014; 48(2):312–319. doi: https://doi.org/f5v385
[42] Tikkanen MK, McInnes CJ, Mercer AA, Büttner M, Tuimala J,
Hirvelä–Koski V, Neuvonen E, Huovilainen A. Recent isolates of
parapoxvirus of Finnish reindeer (Rangifer tarandus tarandus)
are closely related to bovine pseudocowpox virus. J. Gen. Virol.
[Internet]. 2004; 85(Pt6):1413–1418. doi: https://doi.org/cpmpt3
[43] Khalafalla AI, Elhag AE, Ishag HZA. Field investigation and
phylogenetic characterization of Orf virus (ORFV) circulating
in small ruminants and Pseudocowpoxvirus (PCPV) in dromedary
camels of eastern Sudan. Heliyon [Internet]. 2020; 6(3):e03595.
doi: https://doi.org/gt5cv4
[44] Onoja BA, Adamu AM, Anyang SA, Oragwa A, Omeiza GK, Olabode
OH, Horwood PF. Detection and genetic characterization of Orf
virus from sheep and goats in Nigeria. Trop. Anim. Health Prod.
[Internet]. 2024; 56(2):77. doi: https://doi.org/gt5cv5
[45] Babkin I V., Shchelkunov SN. Molecular evolution of poxviruses.
Russ. J. Genet. [Internet]. 2008; 44(8):895–908. doi: https://
doi.org/b8f4rr
[46] Chan KW, Lin JW, Lee SH, Liao CJ, Tsai MC, Hsu WL, Wong ML,
Shih HC. Identication and phylogenetic analysis of Orf virus
from goats in Taiwan. Virus Genes [Internet]. 2007; 35(3):705–
712. doi: https://doi.org/dw7bcd
[47] Yogisharadhya R, Kumar A, Ramappa R. Functional characterization
of recombinant major envelope protein ( rB2L) of Orf virus. Arch.
Virol. [Internet]. 2017; 162(4):953–962. doi: https://doi.org/gt5cv6
[48] Bukar AM, Jesse FFA, Abdullah CAC, Noordin MM, Lawan Z, Mangga
HK., Balakrishnan KN, Azmi MM. Immunomodulatory Strategies
for Parapoxvirus : Current Status and Future Approaches for the
Development of Vaccines against Orf Virus Infection. Vaccines
[Internet]. 2021; 9(11):1341. doi: https://doi.org/gt5cv7
