https://doi.org/10.52973/rcfcv-e34370
Received: 19/12/2023 Accepted: 04/02/2024 Published: 19/05/2024
1 of 7
Revista Científica, FCV-LUZ / Vol. XXXIV, rcfcv-e34370
ABSTRACT
Acute kidney injury (AKI) is a syndrome dened by a rapid decrease
in glomerular filtration that can be caused by sepsis, ischemia/
reperfusion injury (IRI), or nephrotoxic drugs. Human microbiota
makes significant contributions to human health by enzymatic
transformation of such active substances and the release of molecules
such as 3–4 hydroxyphenyl propionic acid (4–HPPA). Biological effects
of 4–HPPA such as anti–inammatory and antioxidant have been
reported in many studies. The aim of the research is to reveal the
anti–inammatory activity of 4–HPPA, one of the microbiota products
of avonoids (especially naringin) found in many fruits, in an in vitro LPS
(lipopolysaccharide) stimulated kidney inammation model. HEK 293
kidney cells of human origin were used as material in the research. The
trial consisted of 4 groups: control group, LPS group, 4–HPPA group
and 4–HPPA+LPS group. LPS and 4–HPPA were applied to the cells
at different concentrations for 24 hours. Effective concentrations
of LPS and 4–HPPA were investigated by MTT viability test. Finally,
IL–1β, TNF–α and NFkβ gene expression analyzes responsible for
inammatory responses were investigated by qRT–PCR method.
According to the findings, after 24 hours of incubation, LPS at
2.5ng·mL
-1
and 4–HPPA at 6.25 μg·mL
-1
were determined to be effective
concentrations for the experiment. Again, it was observed that 4–HPPA
downregulated LPS–induced IL–1β, TNF–α and NFkβ gene expressions
by 7, 42 and 40%, respectively. According to the data obtained from the
research, it was revealed that 4–HPPA had effective anti–inammatory
properties in the in vitro LPS–stimulated kidney inammation model.
However, it was concluded that in vivo and more advanced molecular
methods are needed to fully elucidate the issue.
Key words: Acute kidney injury; 4–HHPA; inammation
RESUMEN
La lesión renal aguda (IRA) es un síndrome denido por una rápida
disminución de la filtración glomerular que puede ser causada
por sepsis, lesión por isquemia/reperfusión (IRI) o fármacos
nefrotóxicos. La microbiota humana contribuye signicativamente
a la salud humana mediante la transformación enzimática de dichas
sustancias activas y la liberación de moléculas como el ácido
3–4 hidroxifenilpropiónico (4–HPPA). En muchos estudios se han
informado efectos biológicos del 4–HPPA, como antiinamatorios y
antioxidantes. El objetivo de la investigación es revelar la actividad
antiinamatoria del 4–HPPA, uno de los productos de la microbiota
de los avonoides (especialmente la naringina) que se encuentran
en muchas frutas, en un modelo de inamación renal estimulada
con LPS (lipopolisacárido) in vitro. Como material de investigación
se utilizaron células renales HEK 293 de origen humano. El ensayo
constaba de 4 grupos: grupo control, grupo LPS, grupo 4–HPPA
y grupo 4–HPPA+LPS. Se aplicaron LPS y 4–HPPA a las células en
diferentes concentraciones durante 24 horas. Se investigaron las
concentraciones efectivas de LPS y 4–HPPA mediante la prueba de
viabilidad de MTT. Finalmente, los análisis de expresión de los genes
IL–1β, TNF–α y NFkβ responsables de las respuestas inamatorias
se investigaron mediante el método qRT–PCR. Según los hallazgos,
después de 24 horas de incubación, se determinó que LPS a 2,5
ng·mL
-1
y 4–HPPA a 6,25 μg·mL
-1
eran concentraciones efectivas
para el experimento. Nuevamente, se observó que 4–HPPA regulaba
negativamente las expresiones de los genes IL–1β, TNF–α y NFkβ
inducidas por LPS en un 7; 42 y 40%, respectivamente. Según los
datos obtenidos de la investigación, se reveló que el 4–HPPA presento
propiedades antiinamatorias efectivas en el modelo de inamación
renal estimulada por LPS in vitro. Sin embargo, se concluyó que se
necesitan métodos moleculares in vivo y más avanzados para dilucidar
completamente el problema.
Palabras clave: Daño renal agudo; 4–HHPA; inamación
Study on the anti–inammatory effect of 3–(4–hydroxyphenyl) propionic
acid in an in vitro LPS–stimulated acute kidney inammation model
Estudio sobre el efecto antiinamatorio del ácido 3–(4–hidroxifenil) propiónico
en un modelo de inamación renal aguda estimulado por LPS in vitro
Altug Kucukgul
1
* , Elif Ozturk Nita
2
1
Hatay Mustafa Kemal University, Faculty of Veterinary, Department of Biochemistry. Antakya, Türkiye.
2
Hatay Mustafa Kemal University, Institute of Health Sciences. Antakya, Türkiye.
*Corresponding Author: altugkucukgul@hotmail.com
3-(4-hydroxyphenyl) propionic acid, anti-inflammatory, kidney, in vitro / Kucukgul and Nita _______________________________________
2 of 7
INTRODUCTION
Sepsis is the most common cause of acute kidney injury and plays a
role in 40–50% of cases [1]. Importantly, the development of acute kidney
injury (AKI) in the setting of sepsis increases the risk of in–hospital death
by 6–8 times [1, 2] and survivors are at predominant risk of progression
to chronic kidney disease [3]. Despite this, the mechanisms by which
sepsis causes AKI are not fully understood and therefore current
treatment is reactive and nonspecic. A growing body of evidence
suggests that, at least in some patients, AKI may occur in the absence
of overt signs of hypoperfusion, and thus other mechanisms may be at
play. Langenberg et al. [4] showed that AKI developed in septic animals
despite normal or increased renal blood ow (RBF).
Citrus fruits are important for human health due to their protective
effects against many diseases such as inammation and cancer. In
particular, naringin, which is predominantly found in its structure, is a
avonoid with a strong antioxidant effect [5 ,6]. In addition, the most
abundant polyphenols in the diet are procyanidins, which have health
benets as antioxidants [7], anti–inammatory [8, 9], anti–aging
[10] and preventing cardiovascular diseases. Although potential
health benecial effects have been attributed, procyanidins are
poorly absorbed in the gastrointestinal tract. However, the colonic
microbiota breaks down procyanidins and converts them into largely
absorbable metabolites, which are responsible for the biological
effects in the body [11]. Procyanidin A2 (PCA2) is abundantly found in
cranberry (Vaccinium macrocarpon)[12], avocado (Persea americana)
[13], red peanut shell (Arachys hypogaea) [14] and litchi fruit pericarp
(Litchi chinensis). The main microbial product of procyanidin A2 is 3–
(4–hydroxyphenyl) propionic acid (HPPA) [15]. In particular, the major
microbial biotransformation product of both naringin and Procyanidin
A2 is 4–HPPA. In particular, the major microbial biotransformation
product of both naringin and Procyanidin A2 is 4–HPPA, and biological
effects are attributed to this component [15, 16]. In the light of this
information, the aim of the study is to reveal the anti–inammatory
activity of 4–HPPA, one of the microbiota products of avonoids
(especially naringin) found in many fruits, in an in vitro LPS–stimulated
kidney inammation model.
MATERIALS AND METHODS
Experimental Trial
Kidney cells of human origin (HEK293 ATCC CRL–1573) from
continuous cell lines were used in the study. Cells were grown in
media Dulbecco's Modied Eagle's Medium (DMEM) containing 10%
fetal bovine serum (FBS) and 1% Penicillin/streptomycin. LPS and 4–
HPPA were commercially available and applied to the cells at different
concentrations (LPS 0.125, 0.25, 1.25, 2.5 ng·mL
-1
; 4–HPPA 2.5, 6.25,
12.5, 25 μg·mL
-1
, respectively) for 24 hours. Effective concentrations
of these substances were determined by Thiazolyl Blue Tetrazolium
Bromide (MTT) viability tests. At the end of the period, the expression
levels of genes encoding IL–1β (Interleukin–1 Beta), TNF–α (tumor
negrosis factor–alpha) and Nuclear Factor kappa B (NFkβ), which are
important markers of inammation, were investigated by full–time
quantitative polymerase chain reaction (qRT–PCR) from the RNA
samples taken from the experimental groups.
Cell Viability Test
The cell viability rate can be determined quantitatively by using
Thiazolyl Blue Tetrazolium Bromide (MTT), on the principle that the
mitochondrial reductases of living cells in a cell population can cleave
the tetrazolium ring in the compound. With the disintegration of the
tetrazolium ring, the yellow MTT molecule turns into a blue–violet
formazan molecule. In this method, briey, after 24 hours of exposure
of LPS and 4–HPPA to the cells, the medium in the wells was removed
and 200 μL of complete medium containing 20 μL of MTT reagent
(obtained by dissolving it in 5 mg·mL
-1
PBS) was added. The cells were
incubated for 4 h at 37°C, and the MTT products were dissolved with
100 μL of 0.04 M hydrochloric acid/isopropanol for 15 min at 37°C.
At the end of the period, the samples taken were centrifuged (Heal
force, Neofuge 13–JAP) at 12000 G and +4°C and their absorbance
was taken at 570 nm light wavelength in a microplate (μQuant ELISA
reader). With this method, the effects of LPS and 4–HPPA on cell
viability were analyzed (n=6).
RNA isolation and qRT–PCR analysis
After 24 hours, the kidney cells were harvested with trypsinization,
and total RNA was isolated using a RNA ekstraction kit (Thermo
Fisher, EU) from four groups, and its amount and purity (OD260/
OD280 nm ratio) were determined on a spectrophotometer (UV mini
1240, Shimadzu, JAP).
For the PCR reaction, a one–step qualied, ready–made commercial
kit with syber green probe marking (5x Hot FIREPol EvaGreen qPCR
Mix plus(Rox)–EU) was used. cDNA conversion was carried out in a
thermal cycler (BioRAD CFX96) by adding appropriate amounts of kit
components (Hot Firepol DNA polymerase, reaction buffer, MgCl
2
,
dNTPs) to the RNA procedure taken from the samples, and a pair of
primers specic to the genes under investigation (oligonucleotide –
TABLE I), and PCR cycles were performed. PCR cycles were carried out
as 40 cycles, with initial activation at 95°C for 12 min, followed by 15 s
denaturation at 95°C, 20 s "Annealing" at 60°C and 20 s "Elongation"
steps at 72°C. With this method, the expression levels of genes
important in the inammatory process, such as Interleukin 1 Beta
(IL–1β), tumor necrosis factor alpha (TNF–α) and nuclear factor kappa
B (NFkβ), were investigated in the RNA samples taken at the end of the
period by optimizing them with the levels of the control gene GAPD
TABLE I
Specic gene sequences used in the research
Genes Forward Reverse
GAPDH 5’–CGTGGCCATCTCTTGCTCGAAG–3’ 5’–CATCGTCACCAACTGGGACGAC–3’
IL–1β 5’–GGTCATTCTCCTGGAAGGAGGTCTGTGGGC–3’ 5’–GCAAGGGCTTCAGGCAGGCCGCG–3’
TNF–α 5’–CAGAGGGAAGAGTTCCCCAG–3’ 5’–CCTTGGTCTGGTAGGAGACG–3’
NFkβ 5’–AGGCAAGGAATAATGCTGTCCTG–3’, 5’–ATCATTCTCTAGTGTCTGGTTGG3’
 









 
    









 
  









 
FIGURE 1. Eects of 4–HPPA on human kidney cell (HEK 293) viabilities. The eective
concentration was determined with the use of dierent concentrations (2.5, 6.25,
12.5 and 25 µg·mL
-1
) of 4–HPPA and MTT analyse was used for all of tests. All data
are mean ± SE and are representative of at least three independent experiments
FIGURE 2. Effect of LPS at different concentrations on the cell viabilities.The
eective concentration was determined with the use of dierent concentrations
(0.125, 0.25, 1.25, 2.5 ng·ml
-1
) of LPS and MTT analyse was used for all of tests. All data
are mean ± SE and are representative of at least three independent experiments
FIGURE 3. Eects of HPPA and LPS on the viability. The eective concentrations
of LPS and LPS+4–HPPA on cell viability was determined by MTT analyse. All data
are mean ± SE and are representative of at least three independent experiments
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34370
3 of 7
Statistical analysis
Viability data were revealed using the "One–way ANOVA" analysis
method of the SPSS 22.0 (Statistical Package for Social Sciences)
package program. Statistical differences were determined by the
"Duncan test". A P–value less than 0.05 was considered statistically
signicant. The ndings of the study were presented as mean ± standard
error (SE). PCR ndings are given with percentage standard errors.
RESULTS AND DISCUSION
Viability results
Human kidney cells (HEK 293) were treated with different
concentrations of LPS and 4–HPPA for 24 hours. After the incubation
period, the viability rates in the cells were revealed by MTT analysis
In the viability findings, when compared to the control group
(0.324 ± 0.014), the cell count at 2.5 and 6.25 μg·mL
-1
concentrations
of 4–HPPA increased by 5.24% (0.341 ± 0.07) and 5.86% (0.343 ± 0.011),
respectively (FIG. 1; P<0.05). However, concentrations of 12.5 and
25 μg·mL
-1
of 4–HPPA reduced by 17.9% (0.266 ± 0.09) and 31.79%
(0.221 ± 0.04), respectively (P<0.05). Based on the data obtained,
since 4–HPPA was effective at a concentration of 6.25 μg·mL
-1
, this
concentration was applied to the cells in gene expression analysis.
Consistent with our data, Zhang et al (15), reported the effects of HPPA
at the concentrations of 6.25, 12.5, 25, 50 and 100 μg·mL
-1
for 24 h on
the cell viability of RAW 264.7 macrophage and the concentration of
6.25 mg·mL
-1
was shown to signicantly increase cell number.
rather than inammatory stimuli such as TNF–α or IFN–γ simulates
bacteriainduced inammation. Therefore, LPS have been used as
a stimuli in in vitro experiments [17–19]. It was shown in a previous
research that LPS caused signicant death in HEK cells [20]. Chen
et al. [21] reported that, in their in vitro microglia LPS–stimulated
dopamine neurotoxicity, LPS application signicantly reduced cell
density, It is shown that these studies are compatible with our data.
When the effects of 4–HPPA and LPS at effective concentrations on
cell viability were examined, it was determined that the cells reduced
by 17.5% (0.267± 0.03) in the trial group in which LPS 2.5 ng·mL
-1
was
added, compared to the control group (0.324 ± 0.015) (P<0.05). Again,
it was revealed that the cell viability was preserved by 11.23% in the
experimental group in which 4–HPPA and LPS were used together
(0.300 ± 0.04) at effective concentrations, compared to the group in
which only LPS was applied (P<0.05) (FIG. 3).
In literature reviews on the subject, no reports showing the
effects of HPPA on cell viability in LPS–stimulated studies were
The results of LPS, indicated that this increased by 0.02%
(0.332 ± 0.010) at 0.125 ng·mL
-1
concentration compared to control
cells (0.3246 ± 0.014) (P<0,05). However, increasing concentrations of
LPS decreased the viability by 3.7% (0.312 ± 0.015), 11.7% (0.286 ± 0.08)
and 17.5% (0.267 ± 0.03) compared to the control, respectively (FIG. 2)
(P<0,05). Based on the data obtained, LPS was found to be effective at
a concentration of 2.5 ng·mL
-1
and was chosen for gene expressions.
Lipopolysaccharides (LPS) is a microbial–derived stimulant as it
is a component of gram negative bacteria cell wall. Utilising LPS
  








  
FIGURE 4. NFkβ expression levels (relative fold change). NFkβ gene expression
levels were determined with the use of LPS alone and in combination with 4–
HPPA. qRT–PCR method was applied for all tests. All data are representative of
at least three independent experiments. Test time was 24 h. All specic gene
expression levels were optimized for the house keeping gene, Standard errors
in the experiment are shown as percentages (%)
  







  
FIGURE 5. IL–1β gene expression. (relative fold change). IL–1β gene expression
levels were determined with the use of LPS alone and in combination with 4–
HPPA. qRT–PCR method was applied for all tests. All data are representative of
at least three independent experiments. Test time was 24 h. All specic gene
expression levels were optimized for the house keeping gene, Standard errors
in the experiment are shown as percentages (%)
3-(4-hydroxyphenyl) propionic acid, anti-inflammatory, kidney, in vitro / Kucukgul and Nita _______________________________________
4 of 7
identied. Naringin which belong to a subclass of avonoid is found
predominantly in citrus fruits. Due to their benecial effects on
human health, they have been discussed in many studies [5, 6, 22,
23]. With its low bioavailability, naringin is poorly absorbed in the
blood circulatory system, suggesting that orally administered naringin
accordingly remains in the gastrointestinal tract for a long time and
is inevitably inuenced by the intestinal microbiota [24]. However,
since HPPA is the metabolite product of naringin, biological activity
can be correlated both naringenin and HPPA [25]. In this context,
in LPS–stimulated dopamine neurotoxicity, it has been that LPS
application naringin administered together with LPS protected it
signicantly compared to LPS [25].
Gene expression results
According to this results, it was found that LPS at the selected
concentration upregulated the NFkβ gene expression level with
16% relative fold changes compared to the control group. In the
group in which LPS was applied together with 4–HPPA, it was found
to be downregulated by 40% compared to the group in which only
LPS was applied (FIG. 4). Inammation is an important aspect of the
pathogenesis of several types of acute and chronic diseases such as
acute kidney injury (AKI) [1]. Macrophages are considered to play an
essential role in inammation. When activated by endotoxin (such
as LPS), macrophages produce inammatory cytokines, which in
turn activate other macrophages and other nearby cells to promote
inammatory gene expression [26, 27]. Binding of exogenous LPS or
endogenous ligands like members of the heat shock protein family
and proteoglycans to TLR4 (e.g. by stimulating the NFkβ signaling
pathway) activates the expression of pro–inammatory cytokines
such as TNF–α, IL–1β, iNOS and IL 6 [17, 28, 29, 30]. Many studies have
reported that LPS causes inammasome formation by stimulating the
expression of inammatory mediators through the NFkβ signaling
pathway. However, naringin or its metabolite HPPA have been shown
to use various mechanisms to interfere with cancer development,
promotion and progression, modulating several unregulated signaling
pathways associated with inammation, proliferation, apoptosis,
autophagy, angiogenesis, invasion and metastasis [15].
In previous studies, Feng et al. [24] and Fu et al. [19] showed that
in AKI, endotoxins such as lipopolysaccharide (LPS) bind to TLR4,
leading to the activation of the NFkβ pathway and the production
of TNF–α and IL–1β cytokines, leading to inltration and activation
of immune cells. Zhang et al. [15] revealed that PCA2 and its major
microbial metabolite (HPPA) signicantly suppressed the activation
of NF–κB pathways induced by ox–LDL, conrming the fact that
inhibition of NF–κB can reduce foam cell formation. It was observed
that the above–mentioned studies coincide with our ndings.
Moreover, LPS up–regulated IL–1β expression by 184% compared
to the control group, while mixed application down–regulated IL–1β
gene expression levels by 7% compared to the LPS–only group (FIG.5).
In a study parallel to our data, it has been reported procyanidin A2
(PCA2) and its major microbial metabolite (HPPA) signicantly that
decreased the ox–LDL–increased levels of IL–6 and IL–1β [15].
According to TNF–α gene expression results, it was found that LPS
at effective concentration upregulated this gene by 12% compared
to the control group. Again, it was found that in the group in which
4–HPPA was applied together with LPS, TNF–α expression was
downregulated by 42% compared to the group in which LPS was
applied (FIG. 6). Peng et al. [30] revealed that IL–6, IL–1β and TNF–α
gene expressions increased signicantly as a result of the interaction
of LPS with TLR–2 in an in vivo septic acute kidney injury model.
Cell Images
In the research, after applying effective concentrations of 4–
HPPA and LPS to kidney cells for 24 hours, cell images (FIG. 7) were
taken from one of the cell wells with a 20x objective of an inverted
microscope (Olympus CKX41–JAP).
  








  
FIGURE 6. TNF–α gene expression levels. TNF–α gene expression levels were
determined with the use of LPS alone and in combination with 4–HPPA. qRT–PCR
method was applied for all tests. All data are representative of at least three
independent experiments. Test time was 24 h. All specic gene expression levels
were optimized for the house keeping gene, Standard errors in the experiment
are shown as percentages (%)
FIGURE 7. Cell images in the control (A), LPS (B), 4–HPPA (C) and LPS+4–HPPA
(D) applied groups (24 h)
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34370
5 of 7
CONCLUSION
In this research, it was observed that LPS applied to cells in an in
vitro kidney inammation model effectively stimulated inammation
and caused cell death. This situation is supported by NFkβ
transcriptor factor, IL1β and TNF–α expression level measurements
and MTT cell viability tests. In addition, we found that 4–HPPA,
signicantly increased cell numbers and reduced the expression
levels of inammatory mediators stimulated by LPS. As a result of
our ndings, the positive effects of HPPA on cell number may be
associated with the suppression of NFkβ, IL–1β and TNF–α gene
expression which have an active role in inammation. In addition,
4–HPPA may be alternative in the treatment of LPS–induced acute
renal injury. However, in vivo experiments and advanced analyzes are
needed to fully elucidate the issue.
Ethical approval
This study was approved by Hatay Mustafa Kemal University
Non–invasive Clinical Trials Local Ethics Committee (Decision No:
2021/09–15).
A
B
C
D
3-(4-hydroxyphenyl) propionic acid, anti-inflammatory, kidney, in vitro / Kucukgul and Nita _______________________________________
6 of 7
Conict of interests
The authors of this study declare that there is no conict of interest
with the publication of this manuscript.
ACKNOWLEDGEMENTS
This study was supported as a master's thesis at Hatay Mustafa
Kemal University, Institute of Health Sciences.
BIBLIOGRAPHICS REFERENCES
[1] Uchino S, Kellum JA, Bellomo R, Doig GS, Morimatsu H, Morgera S,
Schetz M, Tan I, Bouman C, Macedo E, Gibney N, Tolwani A, Ronco
C. Acute renal failure in critically ill patients: a multinational,
multicenter study. JAMA. [Internet]. 2005; 294(7):813–818. doi:
https://doi.org/bpxx33
[2] Thakar CV, Christianson A, Freyberg R, Almenoff P, Render ML.
Incidence and outcomes of acute kidney injury in intensive care
units: a Veterans Administration study. Crit. Care Med. [Internet].
2009; 37(9):2552–2558. doi: https://doi.org/bwf73r
[3] Murugan R, Karajala–Subramanyam V, Lee M, Yende S, Kong L,
Carter M, Angus DC, Kellum JA. Acute kidney injury in non–severe
pneumonia is associated with an increased immune response
and lower survival. Kidney Int. [Internet]. 2010; 77(6):527–535.
doi: https://doi.org/fwqwp3
[4] Langenberg C, Wan L, Egi M, Bellomo R. Renal blood ow in
experimental septic acute renal failure. Kidney Int. [Internet].
2006; 69(11):1996–2002. doi: https://doi.org/bnz7pq
[5] Bacanlı M, Başaran AA, Başaran N. The antioxidant and antigenotoxic
properties of citrus phenolics limonene and naringin. Food Chem.
Toxicol. [Internet]. 2015; 81:160–170. doi: https://doi.org/f7gbqz
[6] Amini N, Sarkaki A, Dianat M, Mard SA, Ahanqarpour A, Badavi
M. Protective effects of naringin and trimetazidine on remote
effect of acute renal injury on oxidative stress and myocardial
injury through Nrf–2 regulation. Pharmacol. Rep. [Internet].
2019; 71(6):1059–1066. doi: https://doi.org/mvxm
[7] Constanza KE, White BL, Davis JP, Sanders TH, Dean LL. Value–
added processing of peanut skins: antioxidant capacity, total
phenolics, and procyanidin content of spray–dried extracts. J.
Agric. Food Chem. [Internet]. 2012; 60(43):10776–10783. doi:
https://doi.org/f4b5sh
[8] Martinez–Micaelo N, González–Abuín N, Ardèvol A, Pinent M,
Blay MT.Procyanidins and inammation: Molecular targets and
health implications. BioFactors. [Internet]. 2012; 38(4):257–265.
doi: https://doi.org/gtd2zm
[9] Sawyer GM, Stevenson DE, McGhie TK, Hurst RD. Suppression of
CCL26 and CCL11 generation in human alveolar epithelial cells
by apple extracts containing procyanidins. J. Funct. Foods.
[Internet]. 2017; 31:141–151. doi: https://doi.org/f93hzh
[10] Fraga CG, Oteiza PI. Dietary avonoids: Role of (−)–epicatechin
and related procyanidins in cell signaling. Free Radical Biol. Med.
[Internet]. 2011; 51(4):813–823. doi: https://doi.org/ctkd72
[11] Monagas M, Urpi–Sarda M, Sánchez–Patán F, Llorach R, GarridoI,
Gómez–Cordovés C Andres–Lacueva C, Bartolomé B. Insights
into the metabolism and microbial biotransformation of dietary
avan–3–ols and the bioactivity of their metabolites. Food Funct.
[Internet]. 2010; 1(3):233–253. doi: https://doi.org/cw88gg
[12] Lee J. Proanthocyanidin A2 purification and quantification of
American cranberry (Vaccinium macrocarpon Ait.) products. J. Funct.
Foods. [Internet]. 2013; 5(1):144–153. doi: https://doi.org/mvxn
[13] López–Cobo A, Gómez–Caravaca AM, Pasini F, Caboni MA, Segura–
Carretero A, Fernández–Gutiérrez A. HPLC–DAD–ESI–QTOF–MS
and HPLC–FLD–MS as valuable tools for the determination of
phenolic and other polar compounds in the edible part and by–
products of avocado. LWT. [Internet]. 2016; 73:505–513. doi:
https://doi.org/f8249q
[14] Appeldoorn MM, Sanders M, Vincken JP, Cheynier V, Le Guernevé
C, Hollman PCH, Gruppen H. Efficient isolation of major
procyanidin A–type dimers from peanut skins and B–type dimers
from grape seeds. Food Chem. [Internet]. 2009; 117(4):713–720.
doi: https://doi.org/fh8czf
[15] Zhang JY, Wang M, Tian L, Genovese G, Yan P, Wilson JG,
Thadhani R, Mottl AK, Appel GB, Bick AG, Sampson MG, Alper
SL, Friedman DJ, Pollak MR. UBD modifies APOL1–induced
kidney disease risk. Proc. Natl. Acad. Sci. USA. [Internet]. 2018;
115(13):3446–3451. doi: https://doi.org/gdbrfg
[16] Chen Y, Wu H, Nie YC, Li PB, Shen JG, Su WW. Mucoactive effects
of naringin in lipopolysaccharide–induced acute lung injury mice
and beagle dogs. Environ. Toxicol. Pharmacol. [Internet]. 2014;
38(1):279–287. doi: https://doi.org/f62x
[17] Tsan MF, Gao B. Cytokine function of heat shock proteins. Am.
J. Physiol. Cell Physiol. 2004; 286(4):739–744. doi: https://doi.
org/cx2h33
[18] Zhang W, Zhou P, Jiang X, Zhe Fan, Xu X, Wang F. Negative Regulation
of Tec Kinase Alleviates LPS–Induced Acute Kidney Injury in Mice
via the TLR4/NF–[kappa] B Signaling Pathway. Biomed Res. Int.
[Internet]. 2020; 20:3152043. doi: https://doi.org/mvxq
[19] Fu H, Hu Z, Di X, Zhang Q, Zhou R. Tenuigenin exhibits protective
effects against LPS–induced acute kidney injury via inhibiting
TLR4/NF–κB signaling pathway. European J. Pharmacol.
[Internet]. 2016; 791:229–234. doi: https://doi.org/f9dq9z
[20] Darehgazani R, Peymani M, Hashemi MS, Omrani MD, Movafagh
A, Ghaedi K, Nasr–Esfahani MH. PPARγ ameliorated LPS induced
inammation of HEK cell line expressing both human Toll–like
receptor 4 (TLR4) and MD2. Cytotechnol. [Internet]. 2016;
68(4):1337–1348. doi: https://doi.org/f8w3kd
[21] Chen Y, Nie YC, Luo YL, Lin F, Zheng YF, Cheng GH, Wu H, Zhang
KJ, Su WW, Shen JG, Li PB. Protective effects of naringin against
paraquat–induced acute lung injury and pulmonary brosis in
mice. Food Chem. Toxicol. [Internet]. 2013; 58:133–140. doi:
https://doi.org/f47xw4
[22] Pu P, Gao DM, Mohamed S, Chen J, Zhang J, Zhou XY, Zhou NJ,
Xie J, Jiang H. Naringin ameliorates metabolic syndrome by
activating AMP–activated protein kinase in mice fed a high–fat
diet. Arch. Biochem. Biophys. [Internet]. 2012; 518(1):61–70. doi:
https://doi.org/bjcwzd
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34370
7 of 7
[23] Gopinath K, Sudhandiran G. Protective effect of naringin on
3–nitropropionic acid–induced neurodegeneration through the
modulation of matrix metalloproteinases and glial brillary acidic
protein. Can. J. Physiol. Pharm. [Internet]. 2016; 94(1):65–71. doi:
https://doi.org/f8jksj
[24] Feng D, Wang Y, Liu Y, Wu L, Li X, Chen Y, Chen Y, Chen Y, Xu C, Yang
K, Zhou T. DC–SIGN reacts with TLR–4 and regulates inammatory
cytokine expression via NF–κB activation in renal tubular epithelial
cells during acute renal injury. Clin. Exp. Immunol. [Internet]. 2018;
191(1):107–115. doi: https://doi.org/gcrf7d
[25] Chen C, Wei YZ, He XM, Li DD, Wang GQ, Li JJ, Zhang F.
Naringenin produces neuroprotection against LPS–induced
dopamine neurotoxicity via the inhibition of microglial NLRP3
inammasome activation. Front. Immunol. [Internet]. 2019;
10:936. doi: https://doi.org/gnkq96
[26] Baggiolini M, Dewald B, Moser B: Interleukin–8 and related
chemotactic cytokines–CXC and CC chemokines. Adv. Immunol.
[Internet]. 1993; 55:97–179. doi: https://doi.org/dmckxf
[27] Nathan C. Nitric oxide as a secretory product of mammalian
cells. FASEB J. [Internet]. 1992; 6(12):3051–3064. doi: https://
doi.org/gf2cs8
[28] Kitaoka Y, Munemasa Y, Nakazawa T, Ueno S. NMDA induced
interleukin–1β expression is mediated by nuclear factor–kappa
B p65 in the retina. Brain Res. [Internet]. 2007; 1142:247–255.
doi: https://doi.org/dfmgqm
[29] Okun E, Grioen KJ, Lathia JD, Tang SC, Mattson MP, Arumugam
TV. Toll–like receptors in neurodegeneration. Brain Res. Rev.
[Internet]. 2009; 59(2):278–292. doi: https://doi.org/ffmm6p
[30] Peng Y, Liu L, Wang Y, Yao J, Jin F, Tao T, Yuan H, Shi L, Lu
S. Treatment with toll–like receptor 2 inhibitor ortho–vanillin
alleviates lipopolysaccharide–induced acute kidney injury in
mice. Exp. Ther. Med. [Internet]. 2019; 18(6):4829–4837. doi:
https://doi.org/gsc7ft