DOI: https://doi.org/10.52973/rcfcv-e32120
Recibido: 24/02/2022 Aceptado: 12/04/2022 Publicado: 03/07/2022
1 de 8
Revista Cientíca, FCV-LUZ / Vol. XXXII, rcfcv-e32120, 1 - 8
RESUMEN
Las bacterias espiroquetas Borrelia burgdorferi sensu lato (s.l.) y
Leptospira spp. ocasionan la borreliosis de Lyme y leptospirosis,
respectivamente, ambas enfermedades zoonóticas de importancia
en salud pública. En sus respectivos ciclos epidemiológicos, los
pequeños roedores son hospedadores accidentales y reservorios
naturales de estas bacterias. Se capturaron pequeños roedores
en las comunidades marginadas de Chan San Antonio y Sucopó,
ubicadas en la zona oriente de Yucatán, México. Se tomaron muestras
de vejiga, oreja y riñón y se utilizaron para la extracción del ácido
desoxirribonucleico (ADN) genómico que se empleó para la búsqueda
de ADN de B. burgdorferi s.l. y Leptospira spp. Se capturaron un
total de 82 roedores de las especies Mus musculus, Rattus rattus y
Heteromys gaumeri. En las muestras estudiadas no se encontró ADN
de B. burgdorferi s.l. La infección con Leptospira spp. fue de 1,21 %
(1/82). El único individuo positivo perteneció a la especie M. musculus.
Se concluye que, si bien la frecuencia de infección con Leptospira
spp. fue baja y que no se encontró evidencia de ADN de B. burgdorferi
s.l. en la población estudiada de roedores, no puede descartarse
su participación como hospederos accidentales o reservorios en
los respectivos ciclos de transmisión de los géneros bacterianos
evaluados.
Palabras clave: Pequeños roedores; Leptospira spp.; Borrelia
burgdorferi sensu lato; infección; frecuencia
ABSTRACT
The spirochetes bacteria Borrelia burgdorferi sensu lato (s.l.) and
Leptospira spp. cause Lyme borreliosis and leptospirosis, respectively,
both zoonotic diseases of public health importance. In their respective
epidemiological cycles, small rodents are accidental hosts and natural
reservoirs of these bacteria. Small rodents in two the marginalized
communities of Chan San Antonio and Sucopó located in the eastern
zone Yucatán, Mexico were captured. Bladder, ear, and kidney samples
were taken and used in the genomic deoxyribonucleic acid (DNA)
extraction that was used for DNA search of B. burgdorferi s.l. and
Leptospira spp. A total of 82 rodents of the species Mus musculus,
Rattus rattus, and Heteromys gaumeri were captured. There was no
evidence of B. burgdorferi s.l. DNA in the studied samples. Infection
with Leptospira spp. was 1.21% (1/82). The only positive individual
belonged to the M. musculus species. It is concluded that, although
the frequency of infection with Leptospira spp. was low and no
evidence of DNA B. burgdorferi s.l. was found in the rodent studied
population, their participation as accidental hosts or reservoirs in
the respective transmission cycles of the genera bacteria evaluated
cannot be discarded.
Key words: Small rodents; Leptospira spp.; Borrelia burgdorferi
sensu lato; infection; frequency
Frecuencia de Borrelia burgdorferi sensu lato y Leptospira spp. en pequeños
roedores de Yucatán, México
Frequency of Borrelia burgdorferi sensu lato and Leptospira spp. in small rodents from Yucatan, Mexico
Gerardo Dzib-Paredes
1
, Roger Iván Rodríguez-Vivas
1
, Alonso Panti-May
2
, Henry Noh-Pech
3
,
José Alberto Rosado-Aguilar
1
y Marco Torres-Castro
3
*
1
Universidad Autónoma de Yucatán, Facultad de Medicina Veterinaria y Zootecnia, Laboratorio de Parasitología. Mérida, Yucatán, México.
2
Universidad Autónoma
de Yucatán, Centro de Investigaciones Regionales “Dr. Hideyo Noguchi”, Laboratorio de Zoonosis y otras Enfermedades Transmitidas por Vector. Mérida,
Yucatán, México.
3
Universidad Autónoma de Yucatán, Centro de Investigaciones Regionales “Dr. Hideyo Noguchi”, Laboratorio de Enfermedades Emergentes y
Reemergentes. Mérida, Yucatán, México.
*Correo electrónico: antonio.torres@correo.uady.mx
Frecuencia de Borrelia burgdorferi sensu lato en pequeños roedores en México / Dzib-Paredes y col._____________________________________
2 de 8
INTRODUCCION
Los pequeños roedores que habitan la península de Yucatán,
conformada por los estados de Campeche, Quintana Roo y Yucatán en
el sureste de México, han sido implicados en los ciclos de transmisión
y epidemiológicos de numerosos agentes etiológicos que ocasionan
enfermedades zoonóticas con importancia en salud pública y animal.
Dentro de éstos, las especies de roedores sinantrópicos o comensales
Mus musculus (conocido como “ratón común” o “ratón doméstico”) y
Rattus rattus (conocida como “rata negra o “rata de barco”), y la especie
silvestre Heteromys gaumeri (conocida como “ratón de abazones”)
tienen particular importancia debido a su distribución y la amplia
extensión de las áreas que ocupan, por lo que es frecuente encontrarlos
en ambientes silvestres (conservados) y con acción antropogénica
como peridomicilios e interiores de viviendas [20, 37].
Borrelia es un género de bacterias espiroquetas que contiene
alrededor de 41 especies que se transmiten por la picadura de
ectoparásitos [34]. Históricamente, el género ha sido dividido en
dos grandes grupos según los principales ectoparásitos (reservorios
y vectores) que transmiten a las especies que los conforman y las
características epidemiológicas de las enfermedades que ocasionan:
1) el grupo de la ebre recurrente epidémica o ebre reincidente,
transmitida principalmente por garrapatas de la familia Argasidae, y 2) el
complejo de Borrelia burgdorferi sensu lato (s.l.) que contiene especies
transmitidas principalmente por garrapatas de la familia Ixodidae
y que ocasionan la borreliosis de Lyme [17, 18]. Dentro de los ciclos
enzoóticos de ambos grupos, los pequeños mamíferos, entre ellos
los roedores, son relevantes por que pueden mantener a las bacterias
en sus organismos y también porque son hospedadores accidentales
de los artrópodos que transmiten a las especies de Borrelia [29, 43].
En México, la infección clínica con B. burgdorferi s.l. (borreliosis
de Lyme o ebre transmitida por garrapatas) en humanos, ha sido
registrada en varios Estados del país, sobre todo en habitantes de los
Estados del noreste y centro [8, 10, 25]. De igual forma, también se han
realizado encuestas serológicas en seres humanos con frecuencias
de anticuerpos contra Borrelia en distintos grupos etarios [7, 9].
Leptospira es un género de bacterias espiroquetas con importancia
en salud pública y animal. Las 18 especies del grupo patógeno ocasionan
la enfermedad conocida como leptospirosis, tanto en seres humanos
como en animales infectados, por lo que se han documentado casos en
todo el mundo con distintas tasas de prevalencia e incidencia [4, 36].
Este padecimiento es considerado como enfermedad desatendida o
reemergente según las regiones donde se presenta. En varios países
de América Latina tiene un carácter epidémico y explosivo, generando
casos incontables en temporada de lluvias e inundaciones [28].
En México, la leptospirosis no es una enfermedad de noticación
obligatoria, por lo que se desconocen la prevalencia e incidencia
y las especies que infectan a la población humana [28, 36]. No
obstante, algunos hallazgos epidemiológicos descritos con datos
de organizaciones gubernamentales sugieren que la mortalidad
ocasionada por leptospirosis, puede alcanzar hasta 12,8 %, cifra que
es mayor en comparación con la mortalidad en países como Alemania
(8 %), Trinidad y Tobago (5,8 %), Marruecos (9,5 %) y Barbados (9,8 %),
y el estado de Hawái, Estados Unidos de América (EUA) (0,5 %) [28].
Es bien conocido a nivel mundial la importancia de los pequeños
roedores en el ciclo de transmisión de numerosas especies patógenas
de Leptospira. Gran parte de esta importancia recae en los roedores
sinantrópicos, considerados los principales reservorios de este
género bacteriano [1]. Sin embargo, se sabe que algunas especies
de roedores silvestres pueden participar en el ciclo de transmisión
como hospedadores accidentales [5].
Estudios previos han sugerido que B. burgdorferi s.l. y Leptospira spp.
comparten similitudes en sus respectivos ciclos epidemiológicos, como
los pequeños roedores que son hospedadores portadores o reservorios
de ambos grupos de bacterias [26]. Por lo tanto, el objetivo de esta
investigación fue detectar la presencia de B. burgdorferi s.l. y Leptospira
spp., a través de ensayos de reacción en cadena de la polimerasa
(PCR por sus siglas en inglés), en pequeños roedores capturados en
dos comunidades rurales marginadas del estado de Yucatán, México.
MATERIALES Y METODOS
Sitios de estudio
Los sitios de captura de los pequeños roedores fueron las comisarías
de Chan San Antonio y Sucopó, pertenecientes al municipio de Tizimín,
ubicado al oriente del Estado de Yucatán, México (20°56’ - 21°36’ N
| 87°32 ’- 88°16’ O). Tiene una altitud entre 7 y 10 metros (m) sobre el
nivel del mar y un clima cálido subhúmedo con lluvias en verano con
temperatura media anual de 24 a 26°C y precipitación anual de 1.500
milímetros (mm) [14].
Captura de roedores y toma de muestras biológicas
La captura, extracción y eutanasia de los roedores fue aprobada
por el Comité de Bioética del Campus de Ciencias Biológicas y
Agropecuarias de la Universidad Autónoma de Yucatán (UADY), Mérida,
México (ID de acta: CB-CCBA-D-2019-002).
La captura de los pequeños roedores se realizó a través de un
muestreo por conveniencia. Para ello, se estudiaron 17 viviendas en
la comisaría de Chan San Antonio y tres viviendas en Sucopó. El único
criterio de inclusión fue que los residentes aceptaron la invitación
a participar en el proyecto de investigación. En cada vivienda se
colocaron seis trampas Sherman (7,5 centímetros [cm] x 23 cm x 9
cm; HB Sherman Traps Inc®, EUA) durante dos noches consecutivas, lo
cual arroja un total de 120 noches/trampa. Las trampas se repartieron
en el interior (previo consentimiento de los residentes) y el exterior
de la vivienda (peridomicilio) y fueron revisadas en la mañana de los
días que permanecieron colocadas. Se usó como cebo a una mezcla
de hojuelas de avena (Avena sativa) con esencia articial de vainilla
(Vanilla spp.) [35].
Los roedores capturados fueron trasladados vivos al Laboratorio de
Bacteriología de la Facultad de Medicina Veterinaria y Zootecnia de la
UADY para determinar su especie [23] y procesarlos. Todos los roedores
fueron anestesiados con isourano (Piramal Enterprises Limited®,
India) y se les aplicó la eutanasia mediante dislocación cervical o
sobredosis de pentobarbital sódico como menciona los estatutos
de la American Veterinary Medical Association [39]. Posteriormente,
fueron revisados en búsqueda de ectoparásitos con ayuda de un peine
de marl o caspero (Kique®, modelo OM-0072, México) y pinzas de
disección anatómica (Guttek®, modelo 15-126, México). Seguidamente,
se obtuvieron de manera aséptica muestras de vejiga (3 mm x 3 mm
x 0,2 mm de grosor), oreja (2 mm x 2 mm x 0,4 mm de grosor) [31] y un
riñón completo [35], que se conservaron en tubos para microcentrífuga
(Axygen®, MCT-200-C, Corning®, México) de 1,8 mililitros (mL) embebidos
en etanol al 96% y depositados inmediatamente en ultracongelación
(-79°C) para su preservación y evitar la degradación del material
________________________________________________________________________Revista Cientica, FCV-LUZ / Vol. XXXII, rcfcv-e32120, 1 - 8
3 de 8
biológico (Thermo Scientific®, ULT1786-4-A49, Thermo Fisher
Scientic®, EUA), hasta su uso posterior en la extracción de ácido
desoxirribonucleico (ADN) genómico.
Extracción de ADN genómico y amplicación de gen constitutivo
Todas las muestras biológicas se lavaron con agua bidestilada y
esterilizada durante cinco minutos para retirar el exceso de etanol.
La extracción de ADN genómico se realizó con el kit DNeasy® Blood
& Tissue (QIAGEN®, Alemania) siguiendo el protocolo estandarizado
por el fabricante. La evaluación del ADN extraído para conocer su
concentración y pureza se realizó en un espectrofotómetro Nanodrop®
(Thermo Scientic®, EUA). Asimismo, para corroborar la viabilidad
e integridad de todo el ADN extraído de las muestras biológicas, se
obtuvo la amplicación de un fragmento del control de RNA-GAPDH
con los reactivos, oligonucleótidos y especicaciones incluidos en el
kit RevertAid H Minus First Strand cDNA Synthesis® (Thermo Scientic®,
EUA). Los productos que no presentaron el amplicado correspondiente
(490 pares de bases [pb]) no fueron considerados en la reacción
molecular para la detección de ADN de los patógenos evaluados.
Detección de ADN de Borrelia burgdorferi sensu lato y Leptospira spp.
Para la detección de B. burgdorferi s.l. se realizaron tres PCR (una
convencional y dos anidadas) dirigidas a distintos fragmentos de
su genoma: aB, p66 y ospC, tal como se plantea en la metodología
aplicada por Solís-Hernández y col. [31, 32], de acuerdo con lo descrito
por Bunikis y col. [2, 3] y Jaulhac y col. [15].
Para la detección de Leptospira spp. se realizaron dos PCR (ambas
convencionales) dirigidas a dos fragmentos de su genoma: ácido
ribonucleico (ARN) ribosomal 16S (16S-rRNA) y rpoC [12, 30, 41]. Para
esto, se siguió la metodología aplicada por Suárez-Galaz y col. [33], de
acuerdo con lo descrito por Torres-Castro y col. [40] para 16S-rRNA
y Villareal-Julio y col. [41] para rpoC.
En la TABLA I se describen los oligonucleótidos, tamaños de los
fragmentos amplicados y objetivos de amplicación para cada una
de las reacciones moleculares empleadas en este estudio.
Todas las reacciones realizadas incluyeron controles positivos.
Para B. burgdorferi s.l. se usó ADN genómico de B. burgdorferi sensu
stricto (s.s.) B31 (cepas MSK5 y A3), B. afzelii (cepa 51567), B. garinii
(cepa 51383) y B. turicatae (cepas TCBP2 y 91E135), proporcionados
por la Universidad de Texas A&M en College Station, Texas (EUA).
Para Leptospira spp. se utilizó ADN genómico de L. interrogans.
Asimismo, para corroborar la funcionalidad correcta de las reacciones
se consideraron dos controles negativos, el primero fue una mezcla
de todos los reactivos de la PCR sin ADN templado y el segundo una
mezcla de todos los reactivos más agua grado biología molecular.
La electroforesis de los productos de todas las reacciones
moleculares se realizó en geles de agarosa al 2 % teñidos con bromuro
de etidio al 8 %. Los resultados se visualizaron y registraron en un
fotodocumentador (Bio-Rad®, EUA).
Análisis estadístico
Las variables de la población estudiada de pequeños roedores
(especie, sexo y edad), así como los resultados arrojados por las
PCR realizadas, fueron analizadas con estadística descriptiva para
obtener porcentajes.
TABLA I

Borrelia burgdorferi sensu latoLeptospira
rurales marginadas de Yucatán, México
Patógeno Oligonucleótidos (5’ 3’)




Referencia
Borrelia spp.
PCR convencional
F: AACACACCAGCATCACTTTCAGG
R: GAGAATTAACTCCGCCTTGAGAAGG
235 aB [15]
Borrelia burgdorferi
sensu lato
PCR anidada.
Primera vuelta:
F: GATTTTTCTATATTTGGACACAT
R: TGTAAATCTTATTAGTTTTTCAAG
Segunda vuelta:
F: CAAAAAAGAAACACCCTCAGATCC
R: CCTGTTTTTAAATAAATTTTTGTAGCATC
684 p66 [3]
PCR anidada
Primera vuelta:
F: ATGAAAAAGAATACATTAAGTGC
R: ATTAATCTTATAATATTGATTTTAATTAAGG
Segunda vuelta:
F: ATTAATGACTTTATTTTTATTTATATCT
R: TTGATTTTAATTAAGGTTTTTTTGG
585 ospC [2]
Leptospira spp.
PCR convencional
F: GTGAACGGGATTAGATACC
R: CTAGACATAAAGGCCATGA
440 16S-rRNA
[12]
[30]
PCR convencional
F: CAAGGGGTTCATATCAACGATAA
R: GTTCCGGCAGGGATCATGTGACC
353 rpoC [41]