© The Authors, 2025, Published by the Universidad del Zulia*Corresponding author:imen.benbahi@univ-mascara.dz
Keywords:
Botrytis cinerea
Vitis vinifera
Antagonism
Plant growth promotion
Biological control of grapevine gray mold: in vitro and in vivo evaluation of the antagonistic
activity of indigenous Trichoderma harzianum strains (Mascara, Algeria)
Control biológico del moho gris de la vid: evaluación in vitro e in vivo de la actividad antagónica de
cepas indígenas de Trichoderma harzianum (Mascara, Argelia)
Controle biológico da podridão cinzenta da videira: avaliação in vitro e in vivo da atividade antagônica
de cepas indígenas de Trichoderma harzianum (Mascara, Argélia)
Imen Benbahi
1
*
Aoumria Merzoug
1
Mohamed El Amine Kouadri
1
Amel Bennacer
2
Rev. Fac. Agron. (LUZ). 2025, 42(4): e254258
ISSN 2477-9407
DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v42.n4.XV
Crop production
Associate editor: Dra. Lilia Urdaneta
University of Zulia, Faculty of Agronomy
Bolivarian Republic of Venezuela
1
Laboratory of Research on Biological Systems and
Geomatics (L.R.S.B.G), Department of Agronomy, Faculty
of Life and Natural Sciences, University Mustapha Stambouli
of Mascara, 29000, Algeria.
2
Laboratory of Valorization and Conservation of Biological
Ressources (VALCOR), Department of Biology, Faculty
of Sciences, University M’hamed Bougara, Boumerdes,
Algeria.
Received: 25-08-2025
Accepted: 11-11-2025
Published: 11-12-2025
Abstract
Gray mold, caused by the necrotrophic fungus Botrytis cinerea,
was responsible for signicant economic losses in grapevine
(Vitis vinifera L.) production worldwide, including Algeria, which
highlighted the need for sustainable control alternatives. The
objective of this study was to evaluate the antagonistic potential
of an indigenous Trichoderma harzianum strain against local B.
cinerea isolates from Mascara, Algeria. A highly virulent B. cinerea
isolate (BC3) was collected from infected grapevine leaves and
identied through morphological and molecular analyses, while
the antagonistic T. harzianum isolate (T5) was obtained from the
rhizosphere of healthy vines. In vitro dual-culture assays showed
that T. harzianum signicantly inhibited the mycelial growth of B.
cinerea, with direct inhibition of 80.50 % and indirect inhibition
of 72.87 %. In vivo experiments further conrmed its ecacy,
reducing disease incidence by 56.25 % and enhancing plant growth,
increasing height from 60 to 96 cm with notable improvement in
vegetative biomass. These ndings suggested that the indigenous T.
harzianum T5 strain was a promising and eective biocontrol agent
for the sustainable management of gray mold in vineyard.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2025, 42(4): e254258 October-December. ISSN 2477-9409.
2-7 |
Resumen
El moho gris, causado por el hongo necrotróco Botrytis cinerea,
ha sido responsable de perdidas económicas signicativas en la
producción de vid (Vitis vinifera L.) en todo el mundo, incluyendo
Argelia, lo que resalta la necesidad de alternativas de control
sostenibles. El objetivo de este estudio fue evaluar el potencial
antagónico de una cepa autóctona de Trichoderma harzianum contra
aislados locales de B. cinerea de Mascara, Argelia. Un aislado
altamente virulento de B. cinerea (BC3) se recolectó de hojas de
vid infectadas y se identicó mediante análisis morfológicos y
moleculares, mientras que el aislado antagonista de T. harzianum
(T5) se obtuvo de la rizosfera de vides sanas. Los ensayos de cultivo
dual in vitro mostraron que T. harzianum inhibió signicativamente
el crecimiento micelial de B. cinerea, con una inhibición directa del
80,50 % y una inhibición indirecta del 72,87 %. Experimentos in
vivo conrmaron aún más su ecacia, reduciendo la incidencia de la
enfermedad en un 56,25 % y acelerando el crecimiento de las plantas,
aumentando su altura de 60 a 96 cm, con una notable mejora en la
biomasa vegetativa. Estos resultados sugieren que la cepa nativa T.
harzianum T5 es un agente de biocontrol prometedor y ecaz para el
manejo sostenible de la podredumbre gris en viñedos.
Palabras clave: Botrytis cinerea, Vitis vinifera, antagonismo,
promoción de crecimiento vegetal.
Resumo
O mofo cinzento, causado pelo fungo necrotróco Botrytis
cinerea, foi responsável por perdas econômicas signicativas na
produção de videira (Vitis vinifera L.) em todo o mundo, incluindo
a Argélia, o que destacou a necessidade de alternativas de controle
sustentáveis. O objetivo deste estudo foi avaliar o potencial
antagônico de uma cepa indígena de Trichoderma harzianum contra
isolados locais de B. cinerea de Mascara, Argélia. Um isolado
altamente virulento de B. cinerea (BC3) foi coletado de folhas de
videira infectadas e identicado por meio de análises morfológicas
e moleculares, enquanto o isolado antagonista de T. harzianum (T5)
foi obtido da rizosfera de videiras saudáveis. Ensaios de dupla cultura
in vitro mostraram que T. harzianum inibiu signicativamente o
crescimento micelial de B. cinerea, com inibição direta de 80,50 %
e inibição indireta de 72,87 %. Experimentos in vivo conrmaram
ainda mais sua ecácia, reduzindo a incidência da doença em 56,25
% e acelerando o crescimento das plantas, aumentando a altura de
60 para 96 cm, com notável melhora na biomassa vegetativa. Esses
resultados sugerem que a cepa nativa T. harzianum T5 é um agente
de biocontrole promissor e ecaz para o manejo sustentável do mofo
cinzento em vinhedos.
Palavras-chave: Botrytis cinerea, Vitis vinifera, antagonismo,
promoção de crescimento vegetal.
Introduction
The grapevine (V. vinifera) is one of the world’s most economically
important perennial crops, grown across 7.3 million hectares globally
supporting an industry valued at over € 300 billion annually (OIV,
2022). In Algeria, grapevine farming holds signicant historical and
cultural value, especially in regions such as Mascara, which is a major
viticultural area in the northwest. Despite the potential of Algerian
viticulture, the sector faces ongoing challenges, particularly from
fungal diseases including gray mold, caused by Botrytis cinerea Pers.
This necrotrophic pathogen can cause pre and post harvest losses of
up to 50-80 % during severe outbreaks (Rhouma et al., 2023).
B. cinerea is notoriously dicult to control due to its genetic
adaptability, its ability to form persistent sclerotia and its rapid
development of resistance to fungicides (Shao et al., 2021).
Furthermore, the environmental and the health risks associated with
synthetic fungicides have spurred growing interest in sustainable
alternatives, particularly biological control agents (Ayilara et al.,
2023). Trichoderma spp. are well-established biocontrol agents
against B. cinerea, acting through multiple mechanisms such as
competition, mycoparasitism, antibiosis, and induction of systemic
resistance (ISR) in plants (Harman et al., 2004; Lorito et al., 2010).
These fungi, commonly found in soils and adaptable to diverse
environments, colonize the roots of both monocots and dicots,
enhancing disease resistance (Harman et al., 2004). They also produce
extracellular enzymes like cellulases and chitinases with industrial
relevance, and promote plant growth, nutrient assimilation, and stress
tolerance (Lorito et al., 2010). Their use in agriculture contributes to
disease control while reducing reliance on agrochemicals, supporting
sustainable farming practices (Wang et al., 2022).The objective of
this study was to identify the Botrytis species responsible for gray
mold in grapevine in the Mascara region of Algeria, to isolate and
molecularly characterize an indigenous T. harzianum strain from the
vine rhizosphere, and to evaluate its antagonistic potential against B.
cinerea through in vitro and in vivo assays. The ultimate aim was
to establish a basis for the development of a sustainable biological
control strategy to reduce gray mold incidence and promote grapevine
growth.
Materials and methods
Fungal material
Pathogen
Samples of grapevine organs, such as clusters, leaves, and stems,
showing typical gray mold symptoms, were collected from 20
vineyards in the Mascara region (Tighennif, Ghriss, El Bordj, and
Maoussa) in northwest Algeria.
These infected tissues were used to isolate B. cinerea. Small tissue
pieces (5-10 mm) were cut from the edge of the infected areas and
surface sterilized by immersing them in 2.0 % sodium hypochlorite
(NaOCl) for 2 minutes, followed by three washes with sterile distilled
water (30 seconds each) (Leslie and Summerell 2006). After that, the
samples were aseptically dried on sterile lter paper. To avoid bacterial
contamination, four to ve sterile tissue pieces were added to potato
dextrose agar (PDA) plates that were treated with streptomycin (50
mg.L
-1
). For ve to seven days, the plates were incubated at 25 ± 2
°C in the dark. After incubation, a single spore from each isolate was
transferred onto fresh PDA plates. Monosporic isolates were stored
at 4 °C in 20 % (v/v) glycerol, and the isolates were morphologically
characterized to conrm B. cinerea identication.
Antagonist
During 2022-2023 season, a soil sample was collected from the
rhizosphere of a healthy grapevine in the Mascara region (Tighennif).
Trichoderma isolates were obtained using the soil dilution method:
1 g of soil was mixed with 9 mL of sterile water, serially diluted (10
-
¹
to 10
-
⁷) and 0.1 mL from selected dilutions was plated on PDA. After
3 days at 25 °C, colonies showing Trichoderma-like morphology
were puried and stored at 4 °C for later use (Kouadri et al., 2023a).
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Benbahi et al. Rev. Fac. Agron. (LUZ). 2025, 42(4): e254258
3-7 |
measured every 48 hours. Control plates contained only B. cinerea
and were sealed similarly (Kouadri et al., 2023a). Growth inhibition
was calculated using the method described previously for the dual
culture assay. The experiments were repeated three times.
In vivo testing of Trichoderma antagonism against Botrytis
cinerea on grapevine leaves
Inoculum preparation
The B. cinerea isolate (BC3), chosen for its high virulence, and the
Trichoderma isolate (T5), identied as the most potent antagonist were
both cultured on PDA at 25 °C for seven days. Spores were harvested
by gently rubbing the surface of the cultures and suspending them in
sterile distilled water. The B. cinerea conidial suspension was adjusted
to 10⁶ conidia.mL
-
¹ to induce gray mold symptoms (Lian et al., 2018),
while the Trichoderma suspension was diluted to 10⁸ conidia.mL
-
¹ for
protective purposes inoculation (Maruyama et al., 2020).
Field experience and procedure for treating grapevine
A eld trial was carried out in 2024 in the Tighennif region
(Mascara), within the Technical Institute of Fruit Arboriculture and
Viticulture (ITAF), in order to evaluate the in vivo ecacy of the T.
harzianum isolate (T5) against B. cinerea on vines. The sensitive
grape variety ‘Sultanina’ was used to facilitate articial inoculation.
The experimental design included four treatments (table 2), each
replicated ve times, for a total of 20 plants. The Trichoderma
treatment was applied only once at the beginning of the experiment,
using two complementary methods (application to the soil at the base
of the plants to promote root colonization and irrigation with a spore
suspension to ensure homogeneous diusion in the rhizosphere).
These two application methods were part of the same treatment and
were not analyzed separately.
Disease assessment
The quantitative disease scoring method involves assessing
disease incidence by calculating the percentage of diseased plants or
leaves relative to the total number observed. It uses the following
formula (Kouadri et al., 2023b):
This method allows for accurate quantication of disease
frequency in the eld, providing an incidence index expressed as a
percentage.
Statistical analysis
Data collected from the in vitro and in vivo experiments were
analyzed by analysis of variance (ANOVA) in SPSS (Statistical
Package for Social Sciences). Comparisons of means between
treatments were performed using the Tukey test, with a signicance
level set at p<0.05. The in vitro test included three replicates per
treatment, while the in vivo eld trial was conducted with four
treatments, each replicated ve times, for a total of 20 plants.
Plant material
In this experiment, we used the Sultanina variety of V. vinifera,
which is known for its high susceptibility to grapevine gray mold.
Molecular Identication and phylogenetic analysis
DNA was extracted using the NucleoSpin® Food kit (Macherey-
Nagel, Germany). DNA quality and quantity were assessed by
measuring 260/280 and 260/230 absorbance ratios with a NanoDrop®
2000. The ITS and TEF1-α regions were PCR-amplied using an
Applied Biosystems® GeneAmp® PCR System 9700 thermocycler.
ITS1/ITS4 primers targeted the ITS region, while EF-728F/EF-2
primers amplied TEF1-α. For B. cinerea, identication relied on ITS
sequencing alone, whereas the Trichoderma isolate was identied
using both ITS and TEF1-α sequences. PCR reactions (25 µL)
contained 2 µL genomic DNA, 1X Solis BioDyne® Taq buer, 1.5
mM MgCl₂, 0.2 mM dNTPs, 0.4 µM of each primer, and 1 U Solis
BioDyne® Taq polymerase. Thermal cycling for ITS1/ITS4 included:
initial denaturation at 95 °C for 5 min; 35 cycles of 95 °C for 30 s,
55 °C for 30 s, 72 °C for 55 s; and nal extension at 72 °C for 7 min.
For EF-728F/EF-2, the same conditions applied except annealing at
54 °C. PCR products were stained with RedSafe® dye (Intron, South
Korea) and visualized on 1.5 % agarose gels under UV light using a
Bio-Rad® Gel Doc™ System. Sequences were analyzed via BLAST
for isolate identication (White et al., 1990; Carbone and Kohn, 1999).
Trichoderma isolates’ antagonistic eects on Botrytis cinerea
mycelia development in vitro
Dual culture
The dual culture method was used to evaluate the Trichoderma
isolate in vitro antagonistic activity against B. cinerea. On PDA plates
(90 mm), a 6 mm disc of 7-day-old B. cinerea was placed on one side,
and a 6 mm disc of Trichoderma was placed 3 cm apart, on the other
side plates were incubated at 25 °C for 10 days. Controls contained
only B. cinerea in the center (Bekkar et al., 2016). The inhibition of
mycelial growth was calculated using this formula:
Where:
R control is the pathogen’s maximal radial growth in the control.
R test = the pathogen’s radial development when the antagonist
is present.
After 2-6 days of incubation, microscopic observations at the
interaction interface were conducted to evaluate another variable: the
mode of action of Trichoderma on B. cinerea mycelium.
Inhibition of fungal growth by Trichoderma volatile metabolites
The impact of volatile compounds produced by Trichoderma
isolate on B. cinerea growth was evaluated by placing a 6 mm
Trichoderma mycelial disc at the center of a PDA plate, with another
PDA plate containing a 6 mm B. cinerea disc inverted and placed
above it. The two plates were sealed together with Paralm to trap
volatiles and incubated at 25 °C for 10 days. B. cinerea growth was
Table 1: Primers used for molecular characterization of Trichoderma sp.
Non Séquence 5’-3’ Tm Taille fragment Sources
ITS1 TCCGTAGGTGAACCTGCGG 55
700 bp White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC 55
EF-728F CATYGAGAAGTTCGAGAAGG 54
700bp Carbone and Kohn (1999)
EF-2 GGARGTACCAGTSATCATGTT 54
Number of diseased plants or leaves
DI = [ ] x 100
Total number of plants or leaves diseased
(R Control – R Tets)
% Inhibition = [ ] x 100
R Control
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2025, 42(4): e254258 October-December. ISSN 2477-9409.
4-7 |
Tabla 2. Description of the treatments y application methods in order to evaluate the in vivo ecacy of the
Trichoderma harzianum isolate (T5) against Botrytis cinerea on vines.
Treatment Description Application method Fungi involved Notes
T1
Uninoculated
control
Roots irrigated with sterile distilled water
- Leaves sprayed with sterile distilled water
None(control) No fungal inoculation
T2 Pathogen only
Leaves sprayed with a conidial suspension of B.
cinerea
Botrytis cinerea only No Trichoderma
T3 Trichoderma only
Roots irrigated with a conidial suspension of
Trichoderma T5 (soil + irrigation combined)
Trichoderma T5 only No B. cinerea
T4 Combined treatment
Roots irrigated with Trichoderma T5
(soil + irrigation)
Six weeks later, leaves sprayed with B. cinerea
conidial suspension
Trichoderma T5+
B. cinerea
Plants kept under high humidity (e. g,
covered with plastic) for 48 h post-
inoculation
Results and discussion
Cultural and morphological characteristics
Pathogen
Four isolates of Botrytis sp. were isolated from diseased grapevine
plants in total Initially, the colonies grown on PDA were white but
turned gray as they matured. The fungus produced conidia that
are ovoid or round, hyaline, and measured between 11 and 15 μm.
These conidia were clustered at the tips of branched conidiophores.
Additionally, B. cinerea formed sclerotia, which are black, irregularly
shaped structures ranging from 1 to 5 mm in diameter. The mycelium
consisted of septate, grayish or olive-colored cylindrical hyphae,
which can sometimes appear vesicular at the median septum. These
morphological traits were typical of B. species (Yan-gang et al.,
2019). In the present study, one isolate (BC3) has been selected as the
most virulent isolate (unpublished data).
Botrytis cinerea plays a dual and signicant role in agriculture
and viticulture, highlighting its importance. This fungus is primarily
known as the pathogen responsible for “grey mold,” a disease that
aects a wide range of crops, causing substantial economic losses
due to degradation of plant tissues, necrosis of stems and leaves, and
fruit rot both before and after harvest. Thus, this pathogen represents
both a major phyto-pathological threat and a crucial factor in
producing high-quality wine products, illustrating the complexity of
its ecological and economic impact (Rhouma et al., 2023).
Antagonist
A Trichoderma isolate (T5) was obtained from grapevine
rhizosphere soil using the serial dilution method. This isolate was
selected for further experiments based on its strong antagonistic
activity against B. cinerea in preliminary dual culture assays (data not
shown). This isolate exhibited typical characteristic of Trichoderma
sp. Colonies grown on PDA usually formed one or two concentric rings
with production of green conidia. The mycelium was sparse, smooth,
and watery white at rst, but it eventually became a uy aerial
mycelium. The pyramid-shaped conidiophores have many branches,
most of which are arranged in threes or fours. The phialides are ask-
shaped, usually short and wide in the middle, measuring about 4-6
μm in length. The conidia are globose to sub globose, smooth, with an
average diameter of 2-3 μm and exhibit a pale green color. According
to studies reported by Okoth et al. (2007), T. harzianum was the
most frequently isolated species from 60 soil samples collected from
various locations. Isolation by dilution plating on PDA medium is a
commonly used method to obtain pure strains of Trichoderma from
rhizosphere soils. This method makes it possible to choose strains
that may have antagonistic action against phytopathogenic fungi in
addition to morphologically characterizing the isolates. Moreover,
this method facilitates the study of Trichoderma biodiversity across
dierent agricultural ecosystems, supporting their future application
in biological control.
Molecular characterization and phylogenetic analysis
The ITS sequence of BC3 showed 99.80 % similarity with B.
cinerea sequences available in GenBank (OP415635.1, KU992698.1,
OP415636.1). For the Trichoderma isolate (T5), both the ITS and
TEF1-α regions were successfully amplied and analyzed. A BLAST
search of ITS sequences revealed a 100 % match with T. harzianum
sequences (OQ789696.1, MN518418.1), while the TEF1-α sequence
showed 99.66 % similarity with T. harzianum sequences (OQ108506.1,
MK050521.1). The sequences have been deposited in the NCBI
GenBank under accession numbers PV290870.1 (B. cinerea), and
PV290866 (ITS) and PV297897 (TEF1-α) for T. harzianum.
Previous studies have also used ITS and TEF1-α sequencing to
identify Trichoderma isolates, conrming the reliability of these
molecular markers for species-level identication. For example,
Gorman et al. (2023) and Druzhinina et al. (2010) reported high
similarity (>99 %) of ITS and TEF1-α sequences for T. harzianum
isolates, which is consistent with the ndings for isolate T5 in this
study. This supports the accuracy of the molecular identication. This
supports the accuracy of the molecular identication and aligns with
global research conrming T. harzianum as a common and eective
antagonist against phytopathogens. Such comparisons strengthen the
discussion and situate the results within the broader scientic context.
Antagonistic activity of Trichoderma harzianum against
Botritys cinerea
In vitro antagonistic activity of Trichoderma harzianum on
Botrytis cinerea in dual culture
The dual culture method demonstrated that T. harzianum (T5)
signicantly inhibited the growth of B. cinerea (BC3), achieving a
growth inhibition rate of 80.5 % (table 3). After ten days on PDA,
T. harzianum aggressively colonized and sporulated over B. cinerea
colonies, showcasing strong mycoparasitic activity.
Microscopic observations of the interaction zone revealed hyphal
coiling, where Trichoderma hyphae wrapped around those of B.
cinerea, as well as appressorium formation facilitating penetration
into the pathogen’s mycelium. Severe mycelial degradation was
evident, including hyphal lysis, vacuolization, vesicle formation,
cytoplasmic leakage, and coagulation.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Benbahi et al. Rev. Fac. Agron. (LUZ). 2025, 42(4): e254258
5-7 |
Interestingly, T. harzianum also stimulated early sclerotia
production in B. cinerea by day three, underscoring its antagonistic
eect. This rapid inhibition is mainly due to competition for nutrients
and space. Trichoderma isolates typically grow faster than Botrytis,
colonizing the culture medium within four days, consistent with
ndings Yao et al. (2023).
A key antagonistic mechanism observed is mycoparasitism (gure
1), where T. harzianum hyphae encircle and parasitize B. cinerea
hyphae, leading to their lysis (Kuzmanovska et al., 2018). Enzymatic
degradation of mycelial walls by β (1,3)-glucanases, chitinases, and
proteases further weakens the pathogen (Dos Santos et al., 2014),
along with vacuolization of the pathogen’s cytoplasm.
Inhibition of Botrytis cinerea mycelial growth by volatile
metabolites of Trichoderma harzianum
The volatile compound assay further conrmed the antifungal
activity of T. harzianum, showing a 72.87 % inhibition of B. cinerea
growth after seven days compared to the control (table 3).
Widely recognized as an eective biocontrol agent, T. harzianum
exhibited rapid and potent inhibition of B. cinerea growth, with
visible eects occurring within two days post-inoculation.
The antifungal eect involves the production of volatile and non-
volatile metabolites such as harzianic acid, peptaibols, and gliovirin,
which inhibit mycelial growth and spore germination (Khan et al.,
2020). These volatile compounds play a key role in biocontrol, as
supported by recent studies (Saddek et al., 2023).
Table 3. In vitro eect of Trichoderma harzianum on the mycelia
growth of four Botrytis cinerea isolates.
B. cinerea
Radial growth inhibition (%)
Dual culture Volatile compounds
T5-BC01
T5-BC02
T5-BC03
T5-BC04
55.04±1.59 b
54.27±3.03b
80.50±7.08a
74.97±2.23a
51.87±0.43c
50.70±4.40c
72.87±2.78b
63.71±1.86a
p≤0.05 0.000076 0.000027
Figure 1. Direct in vitro confrontation between T. harzianum (T5)
and B. cinerea (BC3). (a) macroscopic observations of the
confrontation, (b) the degradation of pathogenic hyphae
by lysis, (c) the formation of vacuoles within pathogenic
hyphae, (d) the characteristic coiling of antagonistic
hyphae around host structures.
These ndings, which showed up to 80.5 % inhibition of B. cinerea
growth in dual culture and 72.87 % inhibition by volatile compounds,
align with previous studies by Bendahmane et al. (2012) and Mokhtar
and Dehimate (2012), conrming T. harzianum’s strong potential for
sustainable management of gray mold disease in grapevines.
The statistical signicance as evaluated by ANOVA and the Tukey test (p< 0.05) is shown by
various letters for the data displayed (mean ± SD).
Eect of Trichoderma harzianum on vegetative growth and
protection of prapevine plants
Growth promotion and disease suppression by Trichoderma
harzianum
Table 4 shows that treating grapevine roots with T. harzianum spores
signicantly enhanced plant growth compared to controls. Inoculated
plants exhibited greater height, more leaves, and increased biomass,
likely due to improved nutrient uptake, production of growth regulators,
and detoxication of harmful soil substances. In the present study,
complete protection by the T5 strain of T. harzianum was observed in
the treatment where grapevine roots were irrigated with T5 prior to B.
cinerea inoculation (treatment 4). This is supported by the results in
table 4, which show a signicant reduction in disease incidence from
96 % in infected-only plants to 42 % in treated plants. Additionally, leaf
lesions were reduced to 1.49 % in treated vines compared to 5.80-9.09
% in the pathogen-only treatment, demonstrating the eectiveness of
T5 in limiting disease spread.
These results conrm that T. harzianum eectively promotes
grapevine growth and protects against B. cinerea infection, highlighting
its potential as a biocontrol agent. This stimulation was primarily
reected in enhanced axial growth and increased biomass production.
In the present study, the inoculated Trichoderma strain signicantly
reduced the percentage of leaf lesions in grapevines compared to
the controls. This reduction (56.25 %) in disease symptoms likely
contributed, at least in part, to the observed enhancement in plant
growth. Finally, root treatment of grapevine plants with T. harzianum
signicantly reduced disease incidence plants.
The reduction of foliar disease, despite the application of T.
harzianum to the roots, can be explained by the induction of systemic
resistance. As previously discussed, Trichoderma colonizes the root
epidermis and outer cortical layers, releasing bioactive molecules that
trigger defense responses throughout the plant. This systemic eect
enhances resistance in aerial tissues such as leaves, consistent with
the ndings of Kthiri et al. (2020), who reported increased enzymatic
activity and activation of defense systems following T. harzianum
treatment.
These results corroborate previous work showing that
Trichoderma can promote plant growth through hormone production,
improved nutrient uptake, and the reduction of abiotic and biotic
stresses (Harman et al., 2021).
However, the present study was conducted under semi-commercial
eld conditions, within an experimental vineyard of the ITAF station.
Therefore, while our results highlight the potential of T. harzianum as
a component of integrated pest management (IPM) strategies, further
validation under eld conditions is required.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2025, 42(4): e254258 October-December. ISSN 2477-9409.
6-7 |
If conrmed in the eld, T. harzianum could complement or
replace chemical fungicides for controlling B. cinerea, thereby
reducing the environmental impact of chemical treatments. Its
adaptability to diverse environments and broad antagonistic activity
against plant pathogens also make it an attractive candidate for
biological control programs, including in Algeria, where local isolates
have shownpromising eects.
Table 4. Comparative analysis of the impacts of Trichoderma
harzianum based treatments on leaf health, vine height
growth, and disease incidence in grapevine plants
infected with Botrytis cinerea (BC3) (T5: Trichoderma
harzianum).
Treatments
Number of
healthy leaves
Number of
infected leaves
Height (cm)
Disease
Incidence
(%)
Control 180±0 11±0b 60±0a 5.75
Vine +BC3 13±2c 34±4.58a 50.67±5.86c 96
Vine +
T5+BC3
109.67±9.50b 30.33±0.58a 65.00±3.00b 42
Vine + T5 198.33±10.41a 3±0b 96.00±3.61a 1.49
ANOVA and the Tukey test (p<0.05) were used to establish statistical signicance. The data
displayed (mean ± standard deviation) with dierent letters.
Figure 2. In vivo evaluation of Trichoderma harzianum (T5)
against Botrytis cinerea (BC3) under eld conditions.
(a) Control (no treatment), (b) Grapevine + BC3, (c)
Grapevine + BC3 + T5, (d) Grapevine + T5 only.
Literature cited
Ayilara, M. S., Adeleke, B. S., Akinola, S. A., Fayose, C. A., Adeyemi, U. T.,
Gbadegesin, L. A., Omole, R. K., Johnson R. M., Uthman Q. O &
Babalola, O. O. (2023). Biopesticides as a promising alternative to
synthetic pesticides: A case for microbial pesticides, phytopesticides, and
nanobiopesticides. Frontiers in Microbiology, 14, 1040901. https://doi.
org/10.3389/fmicb.2023.1040901
Bekkar, A. A., Belabid, L., & Zaim, S. (2016). Biocontrol of phytopathogenic
Fusarium spp. by antagonistic Trichoderma. Biopesticides International,
12(1), 37-45. https://connectjournals.com/pages/articledetails/toc025433
Bendahmane, B. S., Mahiout, D., Benzohra, I. E., & Benkada, M. Y. (2012).
Antagonism of three Trichoderma species against Botrytis fabae and B.
cinerea, the causal agents of chocolate spot of faba bean (Vicia faba L.)
in Algeria. World Applied Sciences Journal, 17(3), 278-283. http://idosi.
org/wasj/wasj17(3)12/2.pdf
Carbone, I., & Kohn, L. M. (1999). A method for designing primer sets for
speciation studies in lamentous ascomycetes. Mycologia, 91(3), 553-
556. https://doi.org/10.1080/00275514.1999.12061051
Dos Santos Castro, L., Antoniêto, A. C. C., Pedersoli, W. R., Silva-Rocha, R.,
Persinoti, G. F., & Silva, R. N. (2014). Expression pattern of cellulolytic
and xylanolytic genes regulated by transcriptional factors XYR1 and CRE1
are aected by carbon source in Trichoderma reesei. Gene Expression
Patterns, 14(2), 88-95. https://doi.org/10.1016/j.gep.2014.01.003
Druzhinina, I. S., Kopchinskiy, A. G., Komoń, M., Bissett, J., Szakacs, G.,
& Kubicek, C. P. (2010). An oligonucleotide barcode for species
identication in Trichoderma and Hypocrea. Fungal Genetics and
Biology, 47(4), 385-392. https://doi.org/10.1016/j.fgb.2005.06.007
Gorman, Z., Chen, J., de Leon, A. A. P., & Wallis, C. M. (2023). Comparison
of assembly platforms for the assembly of the nuclear genome of
Trichoderma harzianum strain PAR3. BMC genomics, 24(1), 454. https://
doi.org/10.1186/s12864-023-09544-6
Harman, G. E., Howell C. R., Viterbo A., Chet I. & Lorito, M. (2004). Trichoderma
species-opportunistic, avirulent plant symbionts. Nature Reviews
Microbiology, 2, 43-56. https://doi.org/10.1038/nrmicro797
Harman, G. E., Doni, F., Khadka, R. B., & Upho, N. (2021). Endophytic strains
of Trichoderma increase plants’ photosynthetic capability. Journal
of Applied Microbiology, 130(2), 529-546. https://doi.org/10.1111/
jam.14368
International Organisation of Vine and Wine (OIV). (2022). State of the world
vine and wine sector in 2023. OIV. https://www.oiv.int/sites/default/les/
documents/OIV_Annual_Assessment-2023.pdf
Khan, R. A. A., Najeeb, S., Hussain, S., Xie, B., & Li, Y. (2020). Bioactive
secondary metabolites from Trichoderma spp. against phytopathogenic
fungi. Microorganisms, 8(6), 817. https://doi.org/10.3390/
microorganisms8060817
Kouadri, M. E. A., Bekkar, A. A., & Zaim, S. (2023a). First report of
using Trichoderma -longibrachiatum as a biocontrol agent against
Macrophomina pseudophaseolina causing charcoal rot disease of lentil in
Algeria. Egyptian Journal of Biological Pest Control, 33(1), 38. https://
doi.org/10.1186/s41938-023-00683-2
Kouadri, M. E. A., Bekkar, A. A., & Zaim, S. (2023b). Morphological, molecular
and pathogenic characterization of Macrophomina pseudophaseolina, the
causal agent of charcoal rot disease on lentil (Lens culinaris) in Algeria.
Physiological and Molecular Plant Pathology, 128, 102143. https://doi.
org/10.1016/j.pmpp.2023.102143
Kthiri, Z., Jabeur, M. B., Machraoui, M., Gargouri, S., Hiba, K., & Hamada, W.
(2020). Coating seeds with Trichoderma strains promotes plant growth
and enhances systemic resistance against Fusarium crown rot in durum
wheat. Egyptian Journal of Biological Pest Control, 30, 139. https://doi.
org/10.1186/s41938-020-00338-6
Kuzmanovska, B., Rusevski, R., Jankulovska, M., & Oreshkovikj, K. B. (2018).
Antagonistic activity of Trichoderma asperellum and Trichoderma
harzianum against genetically diverse Botrytis cinerea isolates. Chilean
Journal of Agricultural Research, 78(3), 391-399. http://dx.doi.
org/10.4067/S0718-58392018000300391
Leslie, J. F., & Summerell, B. A. (2006). The Fusarium Laboratory Manual.
Blackwell Publishing / WileyBlackwell. ISBN 9780813819198. https://
doi.org/10.1002/9780470278376
Lian, J., Han, H., Zhao, J., & Li, C. (2018). In-vitro and in-planta Botrytis cinerea
inoculation assays for tomato. Bio-protocol, 8(8), e2810. https://doi.
org/10.21769/BioProtoc.2810
Lorito, M., Woo, S. L., Harman, G. E., & Monte, E. (2010). Translational
research on Trichoderma: From ‘omics to the eld. Annual Review
of Phytopathology, 48(1), 395-417. https://doi.org/10.1146/annurev-
phyto-073009-114314
Maruyama, C. R., Bilesky-José, N., de Lima, R., & Fraceto, L. F. (2020).
Encapsulation of Trichoderma harzianum preserves enzymatic activity and
enhances the potential for biological control. Frontiers in Bioengineering
and Biotechnology, 8, 225. https://doi.org/10.3389/fbioe.2020.00225
Conclusion
Trichoderma harzianum isolate T5 showed strong antifungal
activity against Botrytis cinerea, reducing mycelial growth by 80.5 %
in vitro and disease symptoms by 56.25 % in vivo. Its biocontrol eect
is based on mycoparasitism and antifungal metabolite production,
which also promote grapevine growth. As the rst report of such an
isolate in Algerian vineyards, this study highlights its dual benet for
plant health and pathogen control. T5 holds promise for integration
into eco-friendly IPM programs in viticulture, pending validation
through eld trials.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Benbahi et al. Rev. Fac. Agron. (LUZ). 2025, 42(4): e254258
7-7 |
Mokhtar, H., & Dehimat, A. (2012). Antagonism capability in vitro of Trichoderma
harzianum against some pathogenic fungi. Agriculture Biology
Journal of North America, 3(11), 452-460. https://doi.org/10.5251/
abjna.2012.3.11.452.460
Okoth, S. A., Roimen, H., Mutsotso, B., Muya, E., Kahindi, J., Owino, J. O.,
& Okoth, P. (2007). Land use systems and distribution of Trichoderma
species in Embu region, Kenya. Tropical and Subtropical Agroecosystems,
7(2), 105-122. https://www.redalyc.org/pdf/939/93970205.pdf
Rhouma, A., Hajji-Hed, L., Kouadri, M. E., Atallaoui, K., Matrood, A. A., &
Khrieba, M. I. (2023). Botrytis cinerea: The cause of tomatoes gray
mold. Egyptian Journal of Phytopathology, 51(2), 68-75. https://doi.
org/10.21608/ejp.2023.224842.1101
Saddek, D., Messgo-Moumene, S., Chemat-Djenni, Z., Bendifallah, L., &
Bencheikh, K. (2023). Antagonism of isolates of Trichoderma spp.
against Botrytis cinerea Pers., agent of gray rot of tomato (Lycopersicum
esculentum Mill.) under greenhouse conditions. Journal of Fundamental
and Applied Sciences, 12(2), 583-606. https://doi.org/10.4314/jfas.v12i2.5
Shao, W., Zhao, Y., & Ma, Z. (2021). Advances in understanding fungicide
resistance in Botrytis cinerea in China. Phytopathology, 111(3), 455-463.
https://doi.org/10.1094/PHYTO-07-20-0313-IA
Wang, R., Liu, C., Jiang, X., Tan, Z., Li, H., Xu, S., Zhang, S., Shang, Q., Deising,
H. B., Behrens, S. E, & Wu, B. (2022). The newly identied Trichoderma
harzianum partitivirus (ThPV2) does not diminish spore production
and biocontrol activity of its host. Viruses, 14(7), 1532. https://doi.
org/10.3390/v14071532
White, T. J., Bruns, T., Lee, S. J. W. T., & Taylor, J. (1990). Amplication and
direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR
Protocols, 18(1), 315-322. http://dx.doi.org/10.1016/B978-0-12-372180-
8.50042-1
Yan-gang, P., Qin-ju, T., Xiao-juan, Z., Ying, L., Xiao-fang, S., Zhi-fei, L., Xiao-
bo, Q., Jing, X., Min, Z., Hua-bao, C., Xiao-li, C., Hui-min, T., Li-yun,
S., & Guo-shu, G. (2019). Phenotypic and genetic characterization of
Botrytis cinerea population from kiwifruit in Sichuan Province, China.
Plant Disease, 103(4), 748-758. https://doi.org/10.1094/PDIS-04-18-
0707-RE
Yao, X., Guo, H., Zhang, K., Zhao, M., Ruan, J., & Chen, J. (2023). Trichoderma
and its role in biological control of plant fungal and nematode disease.
Frontiers in Microbiology, 14, 1160551. https://doi.org/10.3389/
fmicb.2023.1160551
