© The Authors, 2024, Published by the Universidad del Zulia*Corresponding author: hgill@ipn.mx
Keywords:
Soybean grain
Lipoxygenase
Lox genes
Single nucleotide polymorphisms
Molecular variation of lipoxygenase-associated genes in grain of commercial Mexican soybean
cultivars
Variación molecular de genes asociados a lipoxigenasas en grano de variedades de soya comercial
mexicana
Variação molecular de genes associados a lipoxigenases em grãos de variedades comerciais de soja
mexicana
Mónica López Fernández
1
Ana María Sifuentes Rincón
2
Francisco Alejandro Paredes Sánchez
3
Nicolás Maldonado Moreno
4
Homar Rene Gill Langarica
1*
Rev. Fac. Agron. (LUZ). 2024, 41(2): e244111
ISSN 2477-9407
DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v41.n2.01
Crop production
Associate editor: Dr. Jorge Vilchez-Perozo
University of Zulia, Faculty of Agronomy
Bolivarian Republic of Venezuela
1
Laboratorio de Biotecnología Vegetal, Centro de
Biotecnología Genómica, Instituto Politécnico Nacional,
Reynosa, Tamaulipas, México.
2
Laboratorio de Biotecnología Animal, Centro de
Biotecnología Genómica, Instituto Politécnico Nacional,
Reynosa, Tamaulipas, México.
3
Universidad Autónoma de Tamaulipas. IA-UAM, Mante,
Tamaulipas, México.
4
INIFAP-Campo Experimental Las Huastecas. Carretera
Tampico-Mante, km 55. Villa Cuauhtémoc, Altamira,
Tamaulipas, México.
Received: 19-01-2024
Accepted: 28-02-2024
Published: 18-03-2024
Abstract
Lipoxygenase enzymes encoded by the Lox1, Lox2 and Lox3 genes
play a crucial role in soybean grain, particularly in the development of o-
avors. Understanding molecular variation within Lox genes is essential
for the improvement of soybean organoleptic traits. This study investigated
the genetic variation in the internal regions of the Lox1, Lox2, and Lox3
genes in mature grain of commercially grown soybean cultivars in Mexico.
Genomic DNA from a diverse panel of Mexican soybean cultivars was
analyzed using resequencing techniques and in-silico analysis. Single
nucleotide polymorphisms (SNP) within the Lox1, Lox2, and Lox3 genes
were identied and characterized. The ndings indicated that Lox3 gene
displayed lower genetic variability compared to Lox1 and Lox2 genes,
specically, was identied a total of 26 SNPs in the Lox1 gene, 11 SNPs in
the Lox2 gene, and 5 SNPs in the Lox3 gene among the examined cultivars.
A non-synonymous SNP variant of the C/C genotype located in exon 6 of the
Lox2 gene was associated with a destabilizing eect on the lipoxygenase 2
enzyme in the Guayparime S-10 and Huasteca 300 cultivars. These ndings
provide insights into the molecular variation of lipoxygenase-associated
genes in Mexican soybean cultivars.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2024, 41(2): e244111 April-June. ISSN 2477-9407.2-7 |
Resumen
Las enzimas lipoxigenasas codicadas por los genes Lox1, Lox2 y
Lox3 desempeñan un papel crucial en el grano de soya, particularmente
en el desarrollo de sabores desagradables. Comprender la variación
molecular dentro de los genes Lox es esencial para el mejoramiento
de las características organolepticas de la soya. Este estudio investigó
la variación genética en las regiones internas de los genes Lox1,
Lox2 y Lox3 en grano maduro de variedades de soya cultivados
comercialmente en México. Se analizó el ADN genómico de un
panel diverso de variedades de soya mexicanas mediante técnicas de
resecuenciación y análisis in silico. Se identicaron y caracterizaron
polimorsmos de un solo nucleótido (SNP) dentro de los genes Lox1,
Lox2 y Lox3. Los hallazgos indicaron que el gen Lox3 mostró una
menor variabilidad genética en comparación con los genes Lox1
y Lox2; especícamente, fueron identicados un total de 26 SNPs
en el gen Lox1, 11 SNPs en el gen Lox2 y 5 SNPs en el gen Lox3
entre las variedades examinadas. Un SNP no sinónimo variante del
genotipo C/C ubicado en el exón 6 del gen Lox2, fue asociado con un
efecto desestabilizador en la enzima lipoxigenasa 2 en las variedades
Guayparime S-10 y Huasteca 300. Estos hallazgos proporcionan
información sobre la variación molecular de los genes asociados a las
lipoxigenasas en variedades de soya mexicanas.
Palabras clave: grano de soya, lipoxigenasa, genes Lox, polimorsmos
de un solo nucleotido.
Resumo
As enzimas lipoxigenases codicadas pelos genes Lox1, Lox2 e
Lox3 desempenham um papel crucial na grão de soja, particularmente
no desenvolvimento de sabores estranhos. Compreender a variação
molecular dentro dos genes Lox é essencial para a melhoria das
características organolépticas da soja. Este trabalho visou pesquisar
a variação genética nas regiões internas dos genes Lox1, Lox2 e Lox3
em grãos maduros de variedades de soja cultivadas comercialmente no
México. O DNA genômico de um painel diversicado de variedades
mexicanas de soja foi analisado usando técnicas de ressequenciamento
e análise in silico. Foram identicados y caracterizados polimorsmos
de nucleotídeo único (SNP) nos genes Lox1, Lox2 e Lox3. Os
resultados indicaram que o gene Lox3 apresentou menor variabilidade
genética em comparação com os genes Lox1 e Lox2, especicamente,
um total de 26 SNPs no gene Lox1, 11 SNPs no gene Lox2 e 5 SNPs
no gene Lox3 foram identicados entre as variedades examinadas.
Uma variante SNP não-sinônima do genótipo C/C localizada no
exon 6 do gene Lox2 foi associada a um efeito desestabilizador na
enzima lipoxigenase 2 nas variedades Guayparime S-10 e Huasteca
300. Estes interesantes ressultados proporcionam informações sobre
a variação molecular dos genes associadas a lipoxigenases nas
variedades mexicanas de soja.
Palabras-chave: grão de soja, lipoxigenase, genes Lox, polimorsmos
de nucleotídeo único.
Introduction
Soybean grain [Glycine max (L.) Merr.] is globally recognized
for its signicance as a protein and oil source in human diets and as a
balanced animal feed (Singh et al., 2020). However, the consumption
of soybean products is limited due to the presence of anti-nutritional
compounds like lipoxygenase enzymes that trigger volatile
compound reactions, resulting in unpleasant avors in commercial
soybean-based products (Carpentieri-Pipolo et al., 2021). The
lipoxygenases facilitate the oxidation of polyunsaturated fatty acids
such as linoleic acid (18:2) and α-linolenic acid (18:3), resulting in
the production of hydroperoxides of unsaturated fatty acids (Lenis
et al., 2010). The enzymatic activity of soybean lipoxygenases has
signicance, particularly in relation to the generation of undesirable
avors during grain processing (Wang et al., 1994; Lee et al., 2014).
The Lox (lipoxygenase) loci play a crucial role in the expression
of the three known lipoxygenase genes in mature soybean grains,
these genes are located in three specic genomic regions. Lox1
(Glyma13g347600; GmLox1) and Lox2 (Glyma13g347500;
GmLox2) genes are found on chromosome 13, while the Lox3 gene
(Glyma13g026300; GmLox3) is located on chromosome 15 (Shin
et al., 2012). The structural composition of all three Lox genes
consists of nine exons and eight introns (Reinprecht et al., 2011).
The Lox2 gene is primarily responsible for the undesirable beany
avor in mature soybean grains (Davies et al., 1987). In past years,
research on lipoxygenases has focused on identifying natural soybean
mutants and generating single, double and triple null mutants through
mutagenesis that lack lipoxygenase activity (Suda et al., 1995; Lenis
et al., 2010). Conventional genetic improvement techniques have
also allowed breeders to develop lines and cultivars that exhibit a
null eect of lipoxygenases (Lee et al., 2014). In Mexico, soybean
production takes place at latitudes below 25° North with the soybean
plant adapted to short-day photoperiods of approximately 13.3 light
hours (Hinson and Hartwig, 1977). In Mexico, commercial soybeans
are grown in states such as Sonora, Sinaloa, and Tamaulipas and are
produced under a seasonal production system. The productive zones
of Sonora and Sinaloa are classied as the Mexican dry tropics, while
the southern zone of Tamaulipas and some coastal states are known
as the Mexican humid tropics. Both dry and humid tropics, have their
own genetic plant breeding program (Ascencio and Maldonado, 1998)
aimed at developing cultivars with high grain yield and tolerance to
pathogens (Maldonado and Ascencio, 2012; Rodríguez-Cota et al.,
2017). It is worth noting that Mexican soybean genetic programs
employ radiation with cobalt-60 to generate genetic variation during
the improvement process (Rodríguez-Cota et al., 2017). The objective
of this study was to investigate the genetic variability of Lox genes
through resequencing and in silico analysis in a Mexican soybean
population, alongside soybean materials devoid of the inuence of
lipoxygenases.
Materials and methods
In this study, a total of 13 soybean materials were analyzed.
Among them, 11 cultivars are commercially available cultivars and
they were developed in Mexico by the National Institute of Forestry,
Agriculture, and Livestock Research (INIFAP) to suit the conditions
of the Mexican humid and dry tropics. The Huasteca-named cultivars,
along with Tamesi and Vernal cultivars, were generously donated by
MSc. Nicolás Maldonado Moreno, a soybean breeder from INIFAP,
for research and academic purposes. Additionally, the Nainari,
Guayparime S-10, and Suaqui 86 soybean cultivars were obtained from
a commercial supplier in the state of Sonora, Mexico. The materials
JP30790 and JP28955 were generously provided for research and
academic purposes by Dr. Shoshi Kikuchi from the Genetic Resources
Center of the National Agriculture and Food Research Organization
at the National Institute of Agrobiological Sciences (NIAS) in Japan.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
López et al. Rev. Fac. Agron. (LUZ). 2024 40(2): e2441113-7 |
The soybean germplasm bank at NIAS (https://www.gene.arc.go.jp/
databases_plant_search_en.php) conrms that JP30790 and JP28955
materials are free from the eect of lipoxygenase or the triple null
eect of Lox genes in mature grain. The Nainari variety is a mutant
variety developed by cobalt 60 from seeds of Suaqui 86 variety and
the Guayparime S-10 variety was developed from the Nainari variety
through crossing and selection (Rodríguez-Cota et al., 2017) (table 1).
Table 1. Soybean germplasm analyzed.
Number Germplasm Adaptation Progenitors
1 JP30790* USA Unknown
2 JP28955* USA Unknown
3 Vernal
+
Mexico D77-12244 X Bedford
4 Huasteca 100° Mexico Santa Rosa X Jupiter
5 Huasteca 200° Mexico F815344 X Santa Rosa
6 Huasteca 300° Mexico H82-1930 X H80-2535
7 Huasteca 400° Mexico DM301
8 Tamesi° Mexico Santa Rosa X H80-2535
9 Huasteca 600° Mexico H88-1880 X H88-3868
10 Huasteca 700° Mexico Santa Rosa X F81-5517
11 Nainari** Mexico Derived from Suaqui 86
12 Suaqui 86** Mexico
(Rad X Cajeme) X
(Tetabiate X Cajeme)
13 Guayparime S-10** Mexico Nainari X PI-171443
*= Soybean accessions deposited in the Japan NIAS gene bank; += North of the
Tamaulipas state; °= South of the Tamaulipas state (humid tropics); **= South of
the Sonora state (dry tropics).
Sequencing of mature grain Lox genes
To amplify the specic regions of the Lox1, Lox2, and
Lox3 genes, specic primers were designed using the DNAStar
LaserGene software. The reference sequences of these genes from
the cultivar Williams 82 V1.1 (GFC_000004515.3), deposited in
the NCBI database, were used for primer design (table 2). For PCR
amplication, 25 ng.µL of template DNA, isolated from young leaves
with Wizard® genomic kit protocol and the PCR Master Mix enzyme
from Promega were used. The thermocycling conditions for each
gene were as follows: an initial denaturation step at 94 °C for 2 min,
followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at
50 °C for 30 s, and elongation at 72 °C for 2.5 min. A nal elongation
step was performed at 72 °C for 5 min. The quality and specicity
of the PCR products were assessed by analyzing them on a 1.2 %
agarose gel electrophoresis, which allowed verication of the expected
amplicon sizes and conrmation of specic amplication (Kumar and
Rani, 2019).
Library construction and sequencing
For sequencing the amplied Lox gene fragments, the samples
were sent to the LANMDA-CBG-IPN National Laboratory. To prepare
the libraries for sequencing, the Nextera Flex Library Kit was used.
Individual indices were incorporated into the libraries for barcoding,
allowing for multiplexing of samples. The library preparation
process followed the Illumina reference guide #1000000025416 v07.
Finally, the prepared libraries were sequenced using the MiniSeq™
Sequencing System, which is an Illumina sequencing platform.
This system performs high-throughput sequencing of the libraries,
generating sequence data for each of the Lox genes in the samples.
Bioinformatic analysis of sequencing data
The sequence reads obtained from the MiniSeq™ Sequencing
System were aligned to the reference genome Williams 82 using the
Burrows-Wheeler Aligner (BWA-MEM) v0.7. This alignment process
helps to map the reads to their corresponding genomic positions. The
aligned reads were then processed using the Picard v1.135 program,
the processed reads were saved in BAM les. To identify variations
in the sequenced data, the Genomic Variant Call Format (GVCF)
workow was employed, specically using the HaplotypeCaller
program. The identied SNPs and single nucleotide variants (SNVs)
were saved in Variant Call Format (VCF) les and underwent ltering
based on specic criteria. These criteria include depth-normalized
variant condence (QD) <2.0, mapping quality (MQ) <40.0, strand
bias (FS) >60.0, HaplotypeScore >13.0, MQRankSum < -12.5, and
Read-PosRank-Sum < -8.0. Filtering helps to ensure the quality and
reliability of the detected variations. Finally, the Infogen software
(Balzarini and Di Rienzo, 2004) was used to determine allelic
frequencies.
Predictive analysis of the eect of SNPs on the protein
The potential eect of each SNP on the structure of the Lox1,
Lox2, and Lox3 genes was analyzed using the Sanger Institute’s
Table 2. Specic primers for the amplication of grain Lox genes of 13 soybean cultivars.
Number Direction Primers sequence Amplicon size* Position of amplicon
Lox1 gene
1 Forward 5’ TTCTTCTTCTTTATTTTCTCATTT 3’ 2,567bp 32-2598
Reverse 5’ GCCAAATTGTGCTCTCA 3’
2 Forward 5’ ACAATTATCCCCTTACCAGTG 3’ 2,495bp 1648-4142
Reverse 5’ TGATGACAGGAGCTAAACACAAAC 3’
Lox2 gene
1 Forward 5’ AGCTTTTCTTTTTCTTGTT 3’ 1,530bp 11-1540
Reverse 5’ AAAAATAAATCAGAATCATAGCAC 3’
2 Forward 5’ CTTTGGGAGCAGGGGAGTC 3’ 3,461bp 741-4201
Reverse 5’ AATAGTGCTCGGTGCTCTTA 3’
Lox3 gene
1 Forward 5’ TGATGCGCAAGAATGTG 3’ 4,346bp 105-4340
Reverse 5’ CACAAAGCAAAGCAGTA 3’
*= nucleotide base pairs
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2024, 41(2): e244111 April-June. ISSN 2477-9407.4-7 |
PFAM 34.0 database (http://pfam.xfam.org/) to identify traits of the
L-1, L-2 and L-3 proteins and obtain information about the function
of the protein. Subsequently, through predictions in the PROVEAN
program (http://provean.jcvi.org/seq_submit.php) the amino acid
changes produced by each SNP were analyzed and their potential
eect on protein stability was determined. The algorithm used
173 supporting sequences and the score thresholds for prediction
were as follows: variants with a score equal to or less than -2.5 are
considered “destabilizing” and variants with a score greater than -2.5
are considered “neutral”. This program pools BLAST results using
CD-HIT with a parameter of 75 % overall sequence identity. The 30-
best cluster of closely related sequences from the set of supporting
sequences that is used to generate the prediction, a delta alignment
score is calculated for each supporting sequence. Scores are averaged
within and across clusters to generate the nal PROVEAN score.
The last step consisted in analyzing the mutated sequence in the
Eukariotic Linear Motif (ELM) platform (http://elm.eu.org/search.
html) to identify putative motifs and nally modeling the protein
in the SWISS-MODEL program (https://swissmodel.expasy.org/
interactive) to determine its functionality.
Results and discussion
Size and traits of Lox genes
The sequences of exons and introns obtained from the Lox1,
Lox2, and Lox3 genes in Mexican soybean grains were compared
to the reference genome Williams 82. The coverage for Lox1, Lox2,
and Lox3 genes was 96 % (4,265 bp), 97.5 % (4,297 bp), and 100 %
(4,346 bp), respectively. Interestingly, the average sequence size of
exons and introns observed in the Mexican soybean population was
found to be greater than that reported by (Reinprecht et al., 2011; Lee
et al., 2014), who studied a mutant genotype and wild-type genotype.
The dierences in sequence size are particularly noticeable in the
Lox1 gene, as both studies reported a deletion of 74 bp in exon 8 of
the mutant genotype.
Lox1 gene
The Lox1 gene sequences in the Mexican soybean population
exhibited 26 SNPs compared to the reference sequence of the
Williams 82 cultivar (table 3). Other studies have reported a lower
number of SNPs associated with normal and null activity of the Lox1
when compared to the reference sequence of the Williams 82 cultivar
(Lenis et al., 2010; Reinprecht et al., 2011; Lee et al., 2014). Of the
26 SNPs found in the Lox1 gene of the Mexican soybean population,
14 were found in introns, while 12 were identied in exons. Out of the
12 SNPs identied in exons, eight were non-synonymous changes,
meaning they resulted in amino acid substitutions. Among these
eight SNPs, ve were transversions (C/A, A/T, G/C) and three were
transitions (A/G, G/A, G/A). The transversion SNPs were located in
exon 2 (C/A), resulting in a His-Asn amino acid change; in exon 4
(A/T), leading to a Glu-Asp amino acid change; and in exon 6 (G/C),
causing a Ser-Thr amino acid change. The most variable exon was
exon 9, which exhibited ve non-synonymous changes. It included two
transversions (G/C, C/A) resulting in Val-Leu and Leu-Ile amino acid
changes, as well as three transitions (A/G, G/A, G/A) leading to amino
acid changes of Ile-Val, Ala-Thr, and Gly-Asp, respectively (table 3).
Lox2 gene
In the Lox2 gene of the Mexican soybean population, a total of 17
SNPs were identied (table 3). Among these SNPs, 11 were located
in non-coding regions, while six were found in coding regions. Out
of the SNPs detected in exons, three SNPs were transversion with
non-synonymous changes. One transversion SNP (G/C) was found in
exon 6, resulting in a Glu-Asp amino acid change. Additionally, two
transversion SNPs (C/A) in exon 9 led to Pro-Thr and Pro-His amino
acid changes, respectively. The predictive analysis of non-synonymous
SNPs in the Mexican soybean population revealed that the G/C SNP
present in exon 6 destabilized the L-2 protein in the homozygous
C/C genotype in Guayparime S-10 and Huasteca 300 cultivars.
Other non-synonymous SNPs in the Lox2 gene have been reported in
previous studies. For example, Wang et al. (1994), Reinprecht et al.
(2011) and Lee et al. (2014) detected a non-synonymous exchange
of T/A in exon 8, resulting in an amino acid change from histidine
to glutamine. They observed that this mutation aected an iron
ligand essential for the activity of L-2, causing enzyme disfunction.
Additionally, Reinprecht et al. (2011) detected an A/A SNP at position
678, leading to the substitution of threonine with lysine in the Lox2
gene. The change to observed in the nsSNP G/C from exon 6 in
the Mexican soybean population led to the substitution of glutamic
acid (GAG) to aspartic acid (GAC) (tables 3, 4) and consequently,
an error occurred in the conformation of the LH2 globular domain
(Lipoxygenase homology 2) within the protein sequence due to the
low conservation of the DOC_PP4_FxxP_1 motifs (position 2-5)
and DOC_USP7_MATH_1 (position 5-9). These modications
altered the conserved ligand-binding site of the protein in the mutated
protein sequence compared to the corresponding protein sequence
of the Williams 82 reference material (accession SM00308, position
17-176). By examining the direct ancestors of the Guayparime S-10
cultivar, it was observed that both the Nainari mutant and the normal
Suaqui 86 cultivars did not contribute the C allelic variant to the
Guayparime S-10 (tables 3 and 4). This is evident from their normal
G/G genotype. Instead, the C allelic variant in the Guayparime S-10
variety originated from the PI-171443 line, which served as a direct
parent in the genetic cross with the Nainari mutant variety during
the development of Guayparime S-10. The PI-171443 line carries the
Rym1 and Rym2 genes, which confer tolerance to Mung Bean Yellow
Mosaic Begomovirus (Rodríguez-Cota et al., 2017; Rani and Kumar,
2020). The allelic contribution of the PI-171443 line to the soybean
population in the Mexican dry tropics, is likely associated with an
improvement in the reduced activity of the L-2 enzyme in mature
grains where Guayparime S-10 exhibited a desirable attribute of low
beany or rancid avor (López-Fernández et al., 2022).
The Huasteca 300 cultivar in the Mexican soybean population
shares genetic information with the Huasteca 100, Tamesi, and
Huasteca 600 cultivars, which were developed using the Iowa and
Jupiter cultivars parents in single (Huasteca 100) and double genetic
crosses (Huasteca 300, Tamesi, and Huasteca 600). However, the
Huasteca 300 cultivar also possesses unique genetic information
contributed by the parent F76-9835, which is not found in any other
Mexican soybean cultivar (table 1). Upon genotyping the nsSNP G/C,
it was observed that the Huasteca 100, Tamesi, and Huasteca 600
cultivars do not exhibit the allelic change from G to C (tables 3 and 4).
Therefore, the C allelic variant causing destabilization of the L-2 protein
in the Huasteca 300 cultivar is likely attributed to the parent F76-9835.
The F76-9835 line was introduced to Mexico for use as a parent in
genetic improvement, primarily aimed at enhancing the long juvenile
trait in Mexican soybean populations. This trait contributes to a delayed
owering time and improved plant size under short photoperiods.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
López et al. Rev. Fac. Agron. (LUZ). 2024 40(2): e2441115-7 |
Table 3. Location and frequency of SNPs.
Number
Reference
location
Gene location SNPs
Allele frequency
Amino acid
change
A G C T
Lox1 gene
1 42329191 Exon 1 T/A 0.2000 0.8000 Arg-Arg
2 42329248 Intron 1 A/T 0.5000 0.5000
3 42329367 Intron 1 G/T 0.8000 0.2000
4 42329383 Intron 1 C/T 0.8000 0.2000
5 42329522 Intron 1 T/A 0.2000 0.8000
6 42329549 Exon 2 C/A 0.2000 0.8000 His-Asn
7 42330262 Intron 3 C/G 0.2917 0.7083
8 42330372 Intron 3 T/G 0.2917 0.7083
9 42330423 Exon 4 A/T 0.7083 0.2917 Glu-Asp
10 42330876 Intron 4 C/T 0.4615 0.5385
11 42330884 Intron 4 T/C 0.2692 0.7308
12 42330888 Intron 4 T/G 0.2692 0.7308
13 42331050 Intron 5 A/C 0.5000 0.5000
14 42331083 Intron 5 G/T 0.4583 0.5417
15 42331134 Intron 5 A/T 0.7083 0.2917
16 42331199 Exon 6 G/C 0.7083 0.2917 Ser-Thr
17 42331273 Intron 6 A/C 0.4167 0.5833
18 42331544 Exon 7 C/T 0.7083 0.2917 Val-Val
19 42332038 Intron 8 C/A 0.2917 0.7083
20 42332188 Exon 9 G/C 0.7083 0.2917 Val-Leu
21 42332220 Exon 9 C/T 0.7083 0.2917 Ala-Ala
22 42332242 Exon 9 G/A 0.2917 0.7083 Ala-Thr
23 42332262 Exon 9 T/C 0.2692 0.7308 Val-Val
24 42332424 Exon 9 C/A 0.2692 0.7308 Leu-Ile
25 42332433 Exon 9 A/G 0.7308 0.2692 Ile-Val
26 42332806 Exon 9 G/A 0.0385 0.9615 Gly-Asp
Lox
2 gene
1 42322045 Intron 1 T/C 0.3571 0.6071
2 42322161 Intron 1 G/A 0.3846 0.6154
3 42323112 Intron 3 G/A 0.3846 0.6154
4 42323153 Intron 3 T/C 0.3846 0.6154
5 42323180 Intron 3 T/G 0.3846 0.6154
6 42323648 Intron 4 C/T 0.6364 0.3636
7 42323835 Intron 5 G/A 0.5000 0.5000
8 42323904 Intron 5 A/G 0.8077 0.1923
9 42324015 Exon 6 G/C 0.8462 0.1538 Glu-Asp
10 42324197 Intron 6 C/A 0.1667 0.8333
11 42324352 Exon 7 C/T 0.9583 0.0417 Thr-Thr
12 42324587 Intron 7 T/A 0.1667 0.8333
13 42324588 Intron 7 A/T 0.8333 0.1667
14 42325120 Exon 9 C/A 0.0385 0.9615 Pro-Thr
15 42325121 Exon 9 C/A 0.0385 0.9615 Pro-His
16 42325167 Exon 9 T/C 0.0385 0.9615 Gly-Gly
17 42325177 Exon 9 C/T 0.9615 0.0385 Leu-Leu
Lox3 gene
1 2125400 Intron 2 A/G 0.3846 0.6154
2 2126115 Exon 5 T/G 0.6154 0.3846 Asp-Glu
3 2126489 Exon 6 G/A 0.6154 0.3846 Arg-Arg
4 2126715 Intron 6 T/G 0.6154 0.3846
5 2127691 Exon 8 A/G 0.3846 0.6154 Ala-Ala
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2024, 41(2): e244111 April-June. ISSN 2477-9407.6-7 |
Table 4. Predictive analysis of the eect of nsSNPs on the protein
in the mexican soybean population.
*Position **nsSNP Exon
Amino
acid
variant
Eect
Destabilized
genotype
Lox1 gene
42329549 C/A 2 H53N Neutral
42331199 G/C 6 S379T Neutral
42332188 G/C 9 V600L Neutral
42332242 G/A 9 A618T Neutral
42332424 C/A 9 L679I Neutral
42332433 A/G 9 I682V Neutral
42332806 G/A 9 G806D Neutral
Lox2 gene
42324015 G/C 6 E393D Destabilizing
C/C
(Guayparime
S-10 and
Huasteca 300)
42325120 C/A 9 P669T Neutral
42325121 C/A 9 P669H Neutral
Lox2 gene
2126115 T/G 9 D382E Neutral
*= Location of the SNP conforms to the reference sequence of the Williams 82
cultivar; **= non synonymous SNPs
In studies by Reinprecht et al. (2011) and Lee et al. (2014), only
three non-synonymous substitutions in exons 2 and 3 were detected,
resulting in amino acid changes. The predictive analysis of the eight
non-synonymous SNPs detected in the Lox1 gene of the Mexican
soybean population showed no destabilization of the L-1 protein. The
PROVEAN analysis supported these ndings by indicating a neutral
eect of the nsSNPs on the L-1 protein (table 4). This neutral eect
was observed not only in the mutant cultivars Nainari and Guayparime
S-10 but also in the JP28955 and JP30790 cultivars, as well as in
the overall Mexican soybean population. These results contrast with
previous reports by Lenis et al. (2010) and Lee et al. (2014), who
identied a 74 bp deletion in exon 8 that inuenced the transcription
of the L-1 protein in mutant lines. The limited genetic variation
observed in the Lox1 gene of the Mexican soybean population can be
attributed to the genome homogenization resulting from the selection
and xation of specic alleles associated with soybean breeding
programs in Mexico (Ascencio and Maldonado, 1998; Rodríguez-
Cota et al., 2017).
Lox3 gene
The Lox3 gene in the Mexican soybean population exhibits
lower genetic variation compared to the Lox1 and Lox2 genes, as
observed in the reference sequence of the Williams 82 material. The
limited genetic variability of the Lox3 gene in the Mexican soybean
population is consistent with previous reports at both the intron and
exon levels (Reinprecht et al., 2011; Lee et al., 2014), suggesting
that the Lox3 gene is less variable than Lox1 and Lox2. In the Lox3
gene of the Mexican soybean population, a total of ve SNPs were
identied (table 3). Two SNPs were located in introns, while three
transversion SNPs were found in exons 5, 6, and 8. Among these
SNPs, the nsSNP T/G in exon 5 resulted in an amino acid change
from aspartic acid to glutamic acid. However, the predictive analysis
of the three non-synonymous SNPs detected in the Lox3 gene of the
Mexican soybean population showed no destabilization of the L-3
protein. Similar changes and polymorphisms have been reported in
the Lox3 gene, both with and without eects on the L-3 protein. For
example, Lenis et al. (2010) detected a nucleotide change in exon 1
compared to the reference sequence of the Williams 82 cultivar. This
nucleotide change altered the reading frame of the Lox3 gene, leading
to the truncation of the functional L-3 protein in mutant soybean
genotypes. Reinprecht et al. (2011) identied three SNPs in exons 6,
7, and 9 between a mutant and wild-type sequence, but these SNPs
did not have an eect on the functioning of the L-3 protein. Lee et al.
(2014) also reported changes in the Lox3 gene. They identied two
non-synonymous G/A nucleotide changes in exons 6 and 9, resulting
in histidine to arginine and isoleucine to valine amino acid changes,
respectively, in a wild-type and mutant genotype.
In silico analysis of SNPs eect on the protein
The predictive analysis of this nsSNP G/C detected in exon 6
revealed the presence of 79 and 65 putative motifs before and after
data ltering, respectively, which is one more than the reference
sequence of cultivar Williams 82. However, it is worth noting that the
L-2 protein aected by the nsSNP G/C at position 42324015 (E393D)
did not exhibit changes in structural conformation compared to the
normal protein as shown in gure 1.
Figure 1. Model of normal L-2 protein (a) and model of the L-2
protein aected by SNP G/C at position 42324015 (b).
Conclusions
In conclusion, our study reveals signicant genetic diversity
within the introns and exons of Lox genes in the Mexican soybean
population, with Lox3 exhibiting less variability compared to Lox1
and Lox2. Notably, nsSNPs found in the Mexican population have
a neutral impact on L-1 and L-3 proteins. Moreover, our analysis
suggests no destabilizing eects on lipoxygenase proteins in
lipoxygenase-free JPs materials, prompting further exploration of
alternative genetic regions and biochemical analyses, including
enzymatic activity assessments and volatile compound quantication.
The G/C E392D nsSNP in exon 6, showcasing destabilizing eects
on L-2 protein in specic cultivars, holds potential as a valuable
polymorphism for enhancing grain quality in Mexican soybean
populations through breeding strategies.
Acknowledgments
Mónica López-Fernández thanks the IPN (BEIFI scholarship) and
CONAHCYT (CONAHCYT scholarship) for providing the student
scholarships that allowed me to carry out doctoral studies and publish
this manuscript.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
López et al. Rev. Fac. Agron. (LUZ). 2024 40(2): e2441117-7 |
Literature cited
Ascencio, L. G., & Maldonado, M. N. (1998). Crecimiento y desarrollo de la soya
en el sur de Tamaulipas, México. Agricultura Técnica en México, 24(2),
99-110. https://www.acuedi.org/ddata/1274.pdf.
Balzarini, M., & Di Rienzo, J. (2004). Info-Gen: Software para análisis estadístico
de datos genéticos. Universidad Nacional de Córdoba. Córdoba.
Argentina. https://www.info-gen.com.ar/.
Carpentieri-Pipolo, V., Barreto, T. P., da Silva, D. A., Abdelnoor, R. V., Marin,
S. R., & Degrassi, G. (2021). Soybean Improvement for Lipoxygenase-
free by Simple Sequence Repeat (SSR) Markers Selection. Journal of
Botanical Research, 3(1), 23-31. https://doi.org/10.30564/jrb.v3i1.2818.
Davies, C. S., Nielsen, S. S., & Nielsen, N. C. (1987). Flavor improvement of
soybean preparations by genetic removal of lipoxygenase-2. Journal
of the American Oil Chemists’ Society, 64(10), 1428-1433. https://doi.
org/10.1007/BF02636994.
Hinson, K., & Hartwig, E. E. (1977). Soybean production in the tropics. FAO. 4,
p222. https://www.cabdirect.org/cabdirect/abstract/19786724286.
Kumar, V., & Rani, A. (2019). Development of lipoxygenase-3 free Indian
soybean using gene-mutation based molecular markers. Indian Journal
of Experimental Biology, 57, 540-544. https://nopr.niscpr.res.in/
handle/123456789/48474.
Lee, K. J., H. Wang, J. E., Velusamy, V., Ha, B. K., Kim, J. B., Kim, S. H., & Kim,
D. S. (2014). Selection and molecular characterization of a lipoxygenase-
free soybean mutant line induced by gamma irradiation. Theoretical and
applied genetics, 127, 2405-2413. https://doi.org/10.1007/s00122-014-
2385-9.
Lenis, J. M., Gillman, J. D., Lee, J. D., Shannon, J. G., & Bilyeu, K. D. (2010).
Soybean seed lipoxygenase genes: molecular characterization and
development of molecular marker assays. Theoretical and Applied
Genetics, 120, 1139-1149. https://doi.org/10.1007/s00122-009-1241-9.
López-Fernández M., Castillo-Ruíz O., & Gill-Langarica H. R. (2022). First
sensory analysis of soybean drinks made from commercial grain grown
in Mexico. Czech Journal of Food Sciences, 40(5), 400-406. https://doi.
org/10.17221/153/2021-CJFS.
Maldonado-Moreno, N., & Ascencio-Luciano, G. (2012). Tamesí, nueva variedad
de soya para el trópico húmedo de México. Revista mexicana de
ciencias agrícolas, 3(8), 1671-1677). https://www.scielo.org.mx/scielo.
php?pid=S2007-09342012000800017&script=sci_arttext.
Rani, A., & Kumar, V. (2020). Translational genomics and breeding in soybean.
Accelerated Plant Breeding, Volume 3: Food Legumes, pp. 343-367.
https://doi.org/10.1007/978-3-030-47306-8_11.
Reinprecht, Y., Luk-Labey, S. Y., Yu, K., Poysa, V. W., Rajcan, I., Ablett, G. R., &
Peter Pauls, K. (2011). Molecular basis of seed lipoxygenase null traits in
soybean line OX948. Theoretical and applied genetics, 122, 1247-1264.
https://doi.org/10.1007/s00122-011-1528-5.
Rodríguez-Cota, F. G., Manjarrez-Sandoval, P., Cortez-Mondaca, E., Sauceda-
Acosta, R. H., Valenzuela-Herrera, V., González-González, D., & Velarde-
Félix, S. (2017). Guayparime S-10, nueva variedad de soya resistente a
mosca blanca y geminivirus para Sinaloa. Revista mexicana de ciencias
agrícolas, 8(1), 241-245. https://doi.org/10.29312/remexca.v8i1.88.
Shin, J. H., Van, K., Kim, K. D., Lee, Y. H., Jun, T. H., & Lee, S. H. (2012).
Molecular sequence variations of the lipoxygenase-2 gene in soybean.
Theoretical and Applied Genetics, 124, 613-622. https://doi.org/10.1007/
s00122-011-1733-2.
Singh, G., Dukariya, G., & Kumar, A. (2020). Distribution, importance and
diseases of soybean and common bean: A review. Biotechnology Journal
International, 24(6), 86-98. https://doi.org/10.9734/bji/2020/v24i630125.
Suda, I., Hajika, M., Nishiba, Y., Furuta, S., & Igita, K. (1995). Simple and rapid
method for the selective detection of individual lipoxygenase isoenzymes
in soybean seeds. Journal of Agricultural and Food Chemistry, 43(3),
742-747. https://doi.org/10.1021/jf00051a034.
Wang, W. H., Takano, T., Shibata, D., Kitamura, K., & Takeda, G. (1994).
Molecular basis of a null mutation in soybean lipoxygenase 2: substitution
of glutamine for an iron-ligand histidine. Proceedings of the National
Academy of Sciences, 91(13), 5828-5832. https://doi.org/10.1073/
pnas.91.13.5828.
