© The Authors, 2022, Published by the Universidad del Zulia*Corresponding author: marco.s.medina@itoaxaca.edu.mx
University of Zulia, Faculty of Agronomy
Bolivarian Republic of Venezuela
Keywords:
GLX-I
Stress
Proteins
Aspergillus
Glyoxalase I (GLX-I) analysis in native maize from Oaxaca, Mexico, infected with Aspergillus
avus in vitro
Análisis de glioxalasa I (GLX-I) en maíces nativos de Oaxaca, México, infectados con Aspergillus
avus in vitro
Análise de Glyoxalase I (GLX-I) em milho nativo de Oaxaca, México, infectado com Aspergillus
avus in vitro
1
Tecnológico Nacional de México/Instituto Tecnológico de
Oaxaca. Avenida Ing. Víctor Bravo Ahuja No. 125, Esquina
Calzada Tecnológico; 68030. Oaxaca, México.
2
Centro de Investigación Facultad de Medicina UNAM-
UABJO. Ex Hacienda de Aguilera S/N, Calz. San Felipe del
Agua, Oaxaca, México.
3
Laboratorio de Bioquímica y Biología Molecular, Centro de
Química del Instituto de Ciencias (ICUAP), Edicio 103F,
Ciudad Universitaria, Benemérita Universidad Autónoma de
Puebla, Puebla, México.
Received: 29-03-2022
Accepted: 04-09-2022
Published: 21-09-2022
Abstract
The glyoxalase system plays an important role in various physiological
processes in plants when they are subjected to different types of stress, whether
physical, chemical or biological. Aspergillus avus is an aatoxin-producing
fungus that contaminates dry grains, leading to a gradual deterioration of the
grains and a signicant reduction in their nutritional value. The objective
of the present study was to evaluate the activity of the enzyme glyoxalase I
(GLX-I) in maize coleoptiles from Oaxaca in response to infection caused
by Aspergillus avus. Nine maize samples from four different races were
analyzed. The samples were inoculated with a suspension of Aspergillus
avus spores of known concentration and total protein extraction and
quantication were performed on the coleoptiles, and GLX-I activity was
determined by quantifying the amount of S-lactoylglutathione produced per
minute. In addition, analysis of gene expression by reverse transcriptase
polymerase chain reaction (RT-PCR) was performed. The inoculated maize
coleoptiles showed symptoms of infection, color changes and wilting. The
concentration of total proteins decreased signicantly in the extracts of four
samples in the presence of the fungus. In the GLX-I analysis, two samples
had the highest enzymatic activity in the infected coleoptile extract with
respect to the healthy one, in addition to presenting greater expression of
the gene in the RT-PCR assay, this due to the response to Aspergillus avus
infection.
Carlos Francisco Varapizuela-Sánchez
1
Marco Antonio Sánchez-Medina
1
*
María del Socorro Pina-Canseco
2
Nora Hilda Rosas-Murrieta
3
Alma Dolores Pérez-Santiago
1
Iván Antonio García-Montalvo
1
Rev. Fac. Agron. (LUZ). 2022, 39(4): e223946
ISSN 2477-9407
DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v39.n4.0
1
Crop Production
Associate editor: Professor Andreina Garcia de Gonzalez
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2022, 39(4): e223946. October-December. ISSN 2477-9407.
2-6 |
Resumen
El sistema glioxalasa juega un papel importante en diversos
procesos siológicos en plantas cuando son sometidas a diferentes
tipos de estrés, ya sean físicos, químicos o biológicos. Aspergillus
avus es un hongo productor de aatoxinas que contamina granos
secos, lo que conlleva a un deterioro paulatino de los granos y la
reducción signicativa de su valor nutrimental. El objetivo del
presente estudio fue evaluar la actividad de la enzima glioxalasa I
(GLX-I) en coleoptilos de maíces de Oaxaca como respuesta a la
infección producida por Aspergillus avus. Se analizaron nueve
muestras de maíz de cuatro razas diferentes. Las muestras se
inocularon con una suspensión de esporas de Aspergillus avus de
concentración conocida y a los coleoptilos se les realizó la extracción
y cuanticación de proteínas totales y se les determinó la actividad
de GLX-I cuanticando la cantidad de S-lactoilglutatión producida
por minuto. Además, se realizó el análisis de la expresión del gen
por reacción en cadena de la polimerasa transcriptasa reversa (RT-
PCR). Los coleoptilos de maíz inoculados presentaron síntomas de
infección, cambios de coloración y marchitamiento. La concentración
de proteínas totales disminuyó signicativamente en los extractos de
cuatro muestras ante la presencia del hongo. En el análisis de GLX-I,
dos muestras tuvieron la mayor actividad enzimática en el extracto
de coleoptilo infectado con respecto al sano, además de presentar
mayor expresión del gen en el ensayo de RT-PCR, esto debido como
respuesta a la infección por Aspergillus avus.
Palabras clave: GLX-I, estrés, proteínas, Aspergillus.
Resumo
O sistema glioxalase desempenha um papel importante em vários
processos siológicos em plantas quando estas são submetidas
a diferentes tipos de estresse, seja físico, químico ou biológico.
Aspergillus avus é um fungo produtor de aatoxinas que contamina
grãos secos, levando a uma deterioração gradual dos grãos e uma
redução signicativa em seu valor nutricional. O objetivo do presente
estudo foi avaliar a atividade da enzima glioxalase I (GLX-I) em
coleóptilos de milho de Oaxaca em resposta à infecção causada por
Aspergillus avus. Nove amostras de milho de quatro raças diferentes
foram analisadas. As amostras foram inoculadas com uma suspensão
de esporos de Aspergillus avus de concentração conhecida e a extração
e quanticação da proteína total foram realizadas nos coleóptilos, e a
atividade do GLX-I foi determinada pela quanticação da quantidade
de S-lactoilglutationa produzida por minuto. Além disso, foi realizada
a análise da expressão gênica por reação em cadeia da polimerase com
transcriptase reversa (RT-PCR). Os coleóptilos de milho inoculados
apresentaram sintomas de infecção, alterações de cor e murchamento.
A concentração de proteínas totais diminuiu signicativamente nos
extratos de quatro amostras na presença do fungo. Na análise de
GLX-I, duas amostras apresentaram a maior atividade enzimática
no extrato de coleóptilo infectado em relação ao saudável, além de
apresentarem maior expressão do gene no ensaio de RT-PCR, isso
devido à resposta à infecção por Aspergillus avus.
Palavras-chave: GLX-I, estresse, proteínas, Aspergillus.
Introduction
Maize is the main agricultural product in Mexico (Rosado and
Villasante, 2021), 18,151,034 million hectares are planted annually,
with an average harvested area of 17,229,616 ha (Agrifood and
Fisheries Information Service [SIAP], 2021), and its diversity is found
in traditional agricultural systems. The crops plant native varieties
and through their knowledge, the preferences and practices they have
developed, they will be able to maintain the diversity in this crop
(Fernández et al., 2013; Cabrera et al., 2015). The so-called “creole
or native breeds” are the result of the traditional manipulation of the
peasants and the environmental variability present in the numerous
ecological niches in which they are cultivated, which contribute to
the conservation and generation of the genetic diversity of the crop,
coming to form new types, varieties or races (Arteaga et al., 2016;
Orozco-Ramírez et al., 2016). Of the 59 breeds identied in the
country (Fernández et al., 2013), 35 are reported in Oaxaca, which
represents 59 % of the total existing diversity in Mexico (Aragón-
Cuevas et al., 2006; Kato, 2009). Maize production in Mexico is
characterized by being cultivated in the rainy season, which during its
growth and storage is exposed to contamination by fungi, including
Aspergillus avus, generating economic losses of production and
production problems public health due to the consumption of food
contaminated by aatoxins (Martínez et al., 2013).
On the other hand, stress is an unavoidable limiting factor for
agriculture and is becoming a major problem in the modern world,
reducing up to 50 % of crop yields globally (Bandyopadhyay et al.,
2016). Plants grown under natural conditions are constantly subjected
to a wide variety of abiotic stresses such as salinity, drought and
toxic metals, which cause the production of cytotoxic compounds
such as methylglyoxal (MG) and the response of macromolecules
to eliminate it (Hasanuzzaman et al., 2017a; Ben et al., 2018).
Methylglyoxal is a natural metabolite and a highly reactive cytotoxic
compound, produced when organisms are subjected to some type
of stress, mainly abiotic (Ghosh, 2017; Borysiuk et al., 2018); it
can damage and modify proteins, lipids, carbohydrates and DNA,
resulting in cell death, therefore it is important for cells to detoxify
to survive (Rohman et al., 2016). MG is removed by the glyoxalase
system mainly by two enzymes, GLX-I and GLX-II. GLX-I catalyzes
the transformation of MG into S-D-lactoylglutathione through the use
of a reduced glutathione (GSH) molecule, while GLX-II catalyzes
the formation of D-lactate from S-D-lactoylglutathione, allowing the
regeneration of the molecule reduced glutathione (Turra et al., 2015);
In this way, the glyoxalase system could play an important role in
plant tolerance to stress by recycling GSH and, therefore, maintaining
the homeostasis of this molecule (Ghosh et al., 2016; Hasanuzzaman
et al., 2017b).
To improve the response of plants to unfavorable growth conditions,
it is necessary to know their response mechanisms to stress. In hybrid
maize, the response of GLX-I was analyzed in samples that showed
resistance to aatoxin production by A. avus (Chen et al., 2004),
however, the activity of this enzyme in native maize from Oaxaca
raised with A. avus has not been studied. Therefore, this research
aimed to analyze the response of GLX-I to infection by A. avus in
coleoptiles of native maize from the state of Oaxaca.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Varapizuela-Sánchez et al. Rev. Fac. Agron. (LUZ). 2022, 39(4): e2239463-6 |
Materials and methods
Samples of native maize from Oaxaca
Nine samples of 4 races from different collection points of native
maize from Oaxaca donated by Flavio Aragón Cuevas, researcher
at the Instituto Nacional de Investigaciones Forestales Agrícolas y
Pecuarias en Oaxaca (INIFAP) were analyzed. Table 1 describes the
samples.
Table 1. Samples of native maize from the state of Oaxaca
evaluated.
Sample Race Color Place of origin
1 Bolita Belatove Central valleys
2 Bolita Yellow Central valleys
3 Bolita Yellow Central valleys
4 Bolita Blue Central valleys
5 Conejo veloz White Costa
6 Bolita White Central valleys
7 Costeño White Costa
8 Zapalote Purple Costa
9 Bolita Blue Central valleys
Aspergillus avus strain
For the infection tests, an A. avus strain isolated from dried
chili peppers marketed in Oaxaca and characterized in the Food
Laboratory of the Tecnológico Nacional de México, Oaxaca campus
for its aatoxin production was used. An aliquot of 0.1 mL of a
concentrated solution of spores was inoculated on plates with potato-
dextrose agar (PDA) medium and incubated for 7 days at 28 ± 2 °C
in a Labolan brand incubator. The spores were recovered in water
containing 0.01% triton and stored at 5 °C until used.
Obtaining maize coleoptiles
To obtain maize coleoptiles, the procedure reported by Varapizuela
et al. (2019) was used. Thirty seeds of each sample were disinfected
by immersion in a 70 % ethyl alcohol solution for 10 minutes and
rinsed three times with sterile distilled water. Five grains of each
sample were placed in a Petri dish with a cotton bed and moistened
lter paper, being this an experimental unit. Three plates were used
as healthy controls inoculated with 50 µL of sterile water and three
more were inoculated with 50 µL of an A. avus spore suspension of
4×10
6
spores.mL
-1
to each grain. The plates were incubated at 28 ± 2
°C for 7 days.
Extraction and quantication of total proteins
Protein extraction was performed by maceration with a 1:2 (w/v)
ratio using the extraction buffer reported by Chen et al. (2007) with
some modications, which contained 0.25 M NaCl, 50 mM Tris-HCl
pH 8.0 and 14 mM β-mercaptoethanol and centrifuging the samples at
12,000 rpm for 15 minutes. The supernatants obtained were quantied
in triplicate by the Bradford technique using a BSA (bovine serum
albumin) standard curve and stored at -20 °C in a Frigidaire® freezer
until used.
GLX-I enzyme activity assay
The glyoxalase I (GLX-I) enzymatic activity of maize coleoptile
extracts from healthy and A. avus-infected samples was determined
according to the assay reported by Chen et al. (2004). The assay
mixture contained 100 mM sodium phosphate buffer pH 7.5, 3.5 mM
methylglyoxal (MG), 1.7 mM reduced glutathione (GSH), and 16.0
mM magnesium sulfate in a nal volume of 1 mL. The mixture was
transferred to a quartz cell and incubated at ± 27 °C for 1 minute. The
reaction began by adding the enzymes of the extracts obtained by
maceration (0.02 mL of crude extract or extract boiled for 10 minutes
at 100 ºC as control) and the formation of S-D-lactoylglutathione
thioester was monitored by measuring the increase in absorbance at
240 nm in a SmartSpecTM 3000 spectrophotometer (BIO-RAD) at
20 minutes. The absorbance was converted to a molar amount using
the molecular coefcient of 3.370 µmol for S-lactoylglutathione. One
unit of absorbance is dened as 1 µM S-lactoylglutathione.min
-1.
The
assay was performed in triplicate for each extract.
Analysis of data
Total protein quantication data were analyzed based on the
mean and standard deviations (means and standard deviation of
three replicates and three values per replicate). Data analysis of
GLX-I activity was determined by analysis of variance and Tukey’s
statistical test using Minitab17 software. The samples that presented a
statistically signicant difference in the enzymatic activity assay were
analyzed by Reverse Transcriptase PCR.
Analysis of GLX-I gene expression by Reverse Transcriptase
PCR
For the extraction of RNA from maize coleoptiles, the Guanidine
Thioisocyanate method (Chomczynski and Sacchi, 1987) was
used and the samples were stored at -20 °C until use. The GLX-I
oligos designed by José Luis Hernández Morales belonging to the
Tecnológico Nacional de México/Instituto Tecnológico de Oaxaca
were used based on the sequences reported in genbank with No.
NCBI AY241545, Forward (5´ GGTAGTGAAGCCTCGAAGG 3´)
and Reverse (3´ GCATTACTACATCCTAGCACAGC 5´), using as
positive control the oligos of the Mac1 maize actin gene (Baker et
al., 2009), Forward (5’ GTGACAATGGCACTGGAATG 3’) and
Reverse (5’ GACCTGACCATCAGGCATCT 3’), No. NCBI J01238,
both with a molecular weight of 900 bp. For the reaction, the Quiagen
kit for RT (Reverse Transcriptase) was used following the supplier’s
instructions and a concentration of 250 ng of maize coleoptile RNA.
The reaction was carried out in a BIO-RAD MyCycler thermal
cycler with a reverse transcriptase at 50 °C, 30 minutes, initial PCR
activation at 95 °C, 15 minutes and 35 cycles of: denaturation at 94
°C, 30 seconds, alignment 52 °C, 30 seconds, extension 72 °C, 45
seconds, ending with a nal extension cycle at 72 °C for 10 minutes.
The PCR products were analyzed on 2% agarose gels. Densitometry
analysis of GLX-I expression in the agarose gel was performed using
ImageJ software version 1.8.0 (https://imagej.net/software/imagej/),
which calculates the area and statistics of the pixels of dened sections
(Schneider et al., 2012). The extraction was performed in triplicate.
Results and discussion
Obtaining maize coleoptiles
Physiological differences were found between the growth of
healthy maize coleoptiles and those infected with A. avus. Healthy
coleoptiles showed greater elongation, light yellow color with hyaline
parts, as well as greater thickness (gure 1a).
All samples of infected coleoptiles presented smaller size, brown
to black pigmentation and wilting (gure 1b), symptoms like those
reported by Varapizuela et al. (2019), where the infection produced
by Aspergillus parasiticus in coleoptiles of native Oaxacan maize
presented wilting and chlorosis. This may be since the fungus uses
the coleoptiles as a substrate for its development.
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2022, 39(4): e223946. October-December. ISSN 2477-9407.
4-6 |
a stress generated by an excess or a decit of nitrogen in the plant,
unlike that reported by Borysiuk et al. (2018), where the excess of
nitrogen in Arabidopsis plants excessively increased the levels of
methylglyoxal, inhibiting the capacity of the detoxifying pathway
of the glyoxalase system and generating severe damage to proteins.
Resistance to stress generated by biotic or abiotic factors in plants
is a mechanism that encompasses many enzymes that counteract the
damage generated by the stress produced, which depend on the type
of plant and growth conditions to present activity (Hasanuzzaman
et al., 2017a; Hasanuzzaman et al., 2017b; Kaur et al., 2017).
Table 2. Enzymatic activity of glyoxalase I (GLX-I) in maize
coleoptiles.
Sample
µmol S-lactoilglutation.mg
-1
of protein.min
-1
Healthy coleoptile Infected coleoptile
1 0.507
bd
0.772
a
2 0.267
cd
0.668
cd
3 0.498
ac
0.649
bd
4 0.302
ad
0.454
bd
5 0.415
ab
0.609
cd
6 0.473
ab
0.637
ab
7 0.436
ab
0.386
bd
8 0.684
ab
0.653
bd
9 0.559
ac
0.551
d
*Values followed by the same letter do not differ signicantly according to
Tukey’s statistical test (p≤ 0.05).
Analysis of GLX-I expression by RT-PCR
Samples 1 and 5 showed more than double the expression of
the gene in infected coleoptiles compared to samples from healthy
coleoptiles. On the other hand, sample 9 of infected coleoptiles
showed lower expression of the gene compared to the healthy
coleoptile, however, the difference was not signicant (gure 3).
Figure 3. RT-PCR products of the GLX-I gene from healthy
maize coleoptiles and those infected with Aspergillus
avus in 2 % agarose gel. Lane 1, amplied actin gene
(900 bp) in healthy sample 1. Lanes 2 to 4, shows 1
healthy. Lanes 5 to 7, sample 1 infected. Lanes 8 to 10,
shows 5 heals. Lanes 11 to 13, sample 5 infected. Lanes
14, to 16, shows 9 healthy. Lanes 17 to 19, sample 9
infected.
Alvarez-Gerding et al. (2015), analyzed the overexpression
of glyoxalase I and glyoxalase II genes in transgenic samples of
reed Phragmites australis compared to wild type when stressed by
salinity. The transgenic samples increased the expression of the
glyoxalase I and II genes, also reducing the physiological damage
caused in the plant compared to the wild type. According to what
was reported by Fountain et al. (2010), in maize samples, the
expression of the GLX-I gene did not show signicant changes in
expression, since the physiological stress induced by drought was
Healty
Contaminated
Figure 1
. Growth of coleoptiles of maize native to Oaxaca from
sample 1 of the bolita race. a) Healthy coleoptile. b)
Coleoptile infected with Aspergillus avus.
Total protein quantication
Samples 2, 3, 5 and 9 showed a signicant decrease in the
concentration of total proteins in relation to healthy coleoptiles
(gure 2). Sadiq et al. (2011), reported a decrease in protein for rice
coleoptiles when the seeds are germinated under anoxic conditions,
however, there was an increase in specic stress response proteins.
The overproduction of reactive oxygen species and cytotoxic
compounds can lead to the malfunction of the synthesis of structural
proteins for plant development, but they can trigger the response
of specic enzymes to counteract the damage caused (Bania and
Mahanta, 2012; Li, 2016).
Figure 2. Quantication of total proteins of the extracts of
healthy maize coleoptiles and those infected with
Aspergillus avus.
GLX-I enzyme activity
In Tukey’s analysis of GLX-I activity (table 2), it was found
that samples 1 and 5 had a statistically signicant higher enzymatic
activity in infected coleoptiles compared to healthy ones, while
sample 9 had higher enzymatic activity in the healthy coleoptile
than in the infected one. This result could indicate that the activity
of the enzyme is not always related to the changes or stress suffered
by the plant. Chen et al. (2004), evaluated the enzymatic activity
of GLX-I in 6 samples of healthy hybrid maize inoculated with A.
avus, reporting that only in one there was a signicant difference
in the enzymatic activity in maize inoculated with the fungus
compared to the control without inoculate, whose data related to
the response of this enzyme with resistance to aatoxin production,
these results coincide with those reported in this investigation.
On the other hand, Ben et al. (2018) reported an increase in the
activity of the glyoxalase system in sorghum plants, when there is
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Varapizuela-Sánchez et al. Rev. Fac. Agron. (LUZ). 2022, 39(4): e2239465-6 |
not enough to stimulate signicant changes. The maize coleoptiles
analyzed in this work that presented higher enzymatic activity and
greater gene expression were more resistant to infection, unlike those
that presented low enzymatic activity and gene expression, since
these changes can be affected by factors such as the environmental
ones, this is because some samples of the same race present different
susceptibility.
The resistance of plants to the stress generated by biotic or
abiotic conditions is a very important issue, since knowing better
the resistance mechanisms will help to improve the treatments to
which they are subjected to increase their quality and production.
Several detoxifying pathways are involved in this process, which are
comprised of many enzymes that are responsible for reducing and
cushioning the damage generated by cytotoxic compounds generated
by adverse growth conditions (Ghosh, 2017; Zhou et al., 2018).
Recent studies have shown that resistance to infection by A. avus in
maize is a trait controlled by multiple genes, however, the behavior of
these genes reported in hybrids is still unknown in native lines that are
considered a great source of genomic wealth and that have adapted to
different growth conditions such as temperature, altitude, humidity,
among others, prevailing from generation to generation (Rajasekaran
et al., 2019). It is important to know the natural response mechanisms
of plants to stress, to nd varieties that are resistant to unfavorable
growth conditions, minimizing production losses and contamination
of seeds by fungi and damage to the health of those who consume the
products.
Conclusions
Faced with the infection of Oaxacan maize coleoptiles by
Aspergillus avus, there was a decrease in total proteins and an
increase in the glyoxalase I response in both gene expression and
enzymatic activity in samples 1 and 5.
The high activity of the enzyme and expression of the gene
participate as a response to the infection of native maize, while low
concentrations of the enzyme and low expression to susceptibility.
However, the results should be analyzed with subsequent resistance
or susceptibility tests.
Literature cited
Álvarez-Gerding X., Cortés-Bullemore R., Medina C., Romero-Romero J. L.,
Inostroza-Blancheteau C., Aquea F. & Arce-Johnson P. (2015). Improved
salinity tolerance in Carrizo Citrange Rootstock through overexpression
of glyoxalase system genes. BioMed Research International, 827951.
https://doi.org/10.1155/2015/827951
Aragón C. F., Taba S, Hernández J. M., Figueroa J. D. & Serrano V. (2006).
Actualización de la información sobre los maíces criollos de Oaxaca.
Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias,
Informe nal SNIB-CONABIO proyecto No. CS002 México D. F. http://
www.conabio.gob.mx/institucion/proyectos/resultados/InfCS002.pdf
Arteaga M. C., Moreno-Letelier A., Mastretta-Yanes A., Vázquez-Lobo A.,
Breña-Ochoa A., Moreno-Estrada A., Eguiarte L. E. & Piñero D. (2016).
Genomic variation in recently collected maize landraces from Mexico.
Genomics Data, 7: 38-45. https://doi.org/10.1016/j.gdata.2015.11.002
Bandyopadhyay R., Ortega-Beltrán A., Akande A., Mutegi C., Atehnkeng J.,
Kaptoge L., Senghor A. L., Adhikari B. N. & Cotty P. J. (2016). Biological
control of aatoxins in Africa: current status and potential challenges in
the face of climate change. World Mycitoxin Journal, 9(5): 771-789.
https://doi.org/10.3920/WMJ2016.2130
Bania I. and Mahanta R. (2012). Evaluation of peroxidases from
various plant sources. International Journal of Scientic and
Research Publications, 2(5). http://citeseerx.ist.psu.edu/viewdoc/
download?doi=10.1.1.387.3615&rep=rep1&type=pdf
Baker R. L., Brown R. L., Chen Z. Y., Cleveland T. E. & Fakhoury A. M.
(2009). A maize lectin-like protein with antifungal activity against
Aspergillus avus. Journal of food protection, 72(1): 120-127. https://doi.
org/10.4315/0362-028X-72.1.120
Ben M. R., El-Omari R., El-Mourabit N., Bouargalne Y. & NHIRI M. (2018).
Changes in the antioxidant and glyoxalase enzyme activities in leaves of
two Moroccan sorghum ecotypes with differential tolerance to nitrogen
stress. Australian Journal of Crop Science, 12(8): 1280-1287. https://
www.cropj.com/mrid_12_8_2018_1280_1287.pdf
Borysiuk K., Ostaszewska-Bugajska M., Vaultier M-N, Hasenfratz-Sauder M-P &
Szal B. (2018). Enhanced formation of methylglyoxal-derived advanced
glycation end products in Arabidopsis under Ammonium Nutrition.
Frontiers in Plant Science, 9: 667. https://doi.org/10.3389/fpls.2018.00667
Cabrera T. J. M., Carballo A. & Aragón-Cuevas F. (2015). Evaluación agronómica
de maíces raza Zapalote chico en la región Istmeña de Oaxaca. Revista
Mexicana Ciencias Agrícolas, 11: 2075-2082. https://doi.org/10.29312/
remexca.v0i11.775
Chen Z. Y., Brown R. L., Damann K. E. & Cleveland T. E. (2004). Identication
of a maize kernel stress-related protein and its effect on aatoxin
accumulation. Phytopathology, 94(9): 938-945. https://doi.org/10.1094/
PHYTO.2004.94.9.938
Chen, Z.-Y., Brown R. L., Damann K. E. & Cleveland T. E. (2007). Identication
of maize kernel endosperm proteins associated with resistance to aatoxin
contamination by Aspergillus avus. Phytopathology, 97(9): 1094–1103.
https://doi.org/10.1094/PHYTO-97-9-1094
Chomczynski P. and Sacchi N. (1987). Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction.
Analytical Biochemistry, 162(1):156-9. https://doi.org/10.1016/0003-
2697(87)90021-2
Fernández S. R., Morales L. A. & A. Gálvez M. (2013). Importancia de los maíces
nativos de México en la dieta nacional. Una revisión indispensable.
Revista Fitotecnia Mexicana, 36(3-A): 275-283. http://www.scielo.org.
mx/pdf/rfm/v36s3-a/v36s3-aa4.pdf
Fountain J. C., Chen Z-Y, Scully B. T., Kamerait R. C., Lee R. D. & Guo B. (2010).
Pathogenesis-related gene expressions in different maize genotypes
under drought stressed conditions. African Journal Plant Science, 4(11):
433-440. https://academicjournals.org/article/article1380126077_
Fountain%20et%20al.pdf
Ghosh A. (2017). Genome-wide identication of glyoxalase genes in Medicago
truncatula and their expression proling in response to various
developmental and environmental stimuli. Frontiers in Plant Science, 8:
836. https://doi.org/10.3389/fpls.2017.00836
Ghosh A., Kushwana H. R., Hasan M. R., Pareek A., Sopory S. K. & Singla-Pareek
S. L. (2016). Presence of unique glyoxalase III proteins in plants indicates
the existence of shorter route for methylglyoxal detoxication. Scientic
Reports, 6:18358. https://doi.org/10.1038/srep18358
Hasanuzzaman M., Nahar K., Hossain Md. S., Mahmud J. A., Rahman A., Inafuku
M., Oku H. & Fujita M. (2017a). Coordinated actions of glyoxalase and
antioxidant defense systems in conferring abiotic stress tolerance in
plants. International Journal Molecular Sciences, 18(1): 200. https://doi.
org/10.3390/ijms18010200
Hasanuzzaman M., Nahar K., Hossain Md. S., Anee T. I., Parvin K. & Fujita M.
(2017b). Nitric oxide pretreatment enhances antioxidant defense and
glyoxalase systems to confer PEG-induced oxidative stress in rapeseed.
Journal of Plant Interaction, 12(1): 323-331. https://doi.org/10.1080/17
429145.2017.1362052
Kato Y. T. A., Mapes C., Mera L. M., Serratos J. A. & Bye R. A. (2009). Origen y
diversicación del maíz; Una revisión analítica. UNAM: México: 115 pp.
https://issuu.com/perrasdelmal/docs/origen_y_diversif._del_maiz
Kaur C., Sharma S., Hasan M. R., Pareek A., Singla-Pareek S. L. & Sopory S.
K. (2017). Characteristic variations and similarities in biochemical,
molecular and functional Properties of glyoxalases across Prokaryotes and
Eukaryotes. International Journal of Molecular Sciences, 18:250. https://
doi.org/10.3390/ijms18040250
Li Z-G. (2016). Methylglyoxal and glyoxalase system in plants: old players, new
concepts. The Botanical Review, 82: 183-203. https://doi.org/10.1007/
s12229-016-9167-9
Rosado O. A. and Villasante S. B. (2021). Los herederos del maíz. Instituto
Nacional de los Pueblos Indígenas, Ciudad de México. https://www.gob.
mx/cms/uploads/attachment/le/658352/Libro-Los-herederos-del-maiz-
INPI.pdf
Martínez P. H. Y., Hernández S., Reyes C. A. & Vázquez-Carrillo G. (2013). El
género Aspergillus y sus micotoxinas de maíz en México: problemática y
perspectivas. Revista Mexicana de Fitopatología, 31(2): 126-146. http://
www.scielo.org.mx/pdf/rm/v31n2/v31n2a5.pdf
Orozco-Ramírez Q., Ross-Ibarra J., Santacruz-Varela A. & Brush S. (2016). Maize
diversity associated with social origin and environmental variation in
Southern Mexico. Heredity, 116(5): 477-484. https://doi.org/10.1038/
hdy.2016.10
Rajasekaran K., Sayler R. J., Majumdar R., Sickler C. M. & Cary J. W. (2019).
Inhibition of Aspergillus avus growth and aatoxin production in
transgenic maize expressing the α-amylase inhibitor from Lablab
purpureus L. Journal of Visualized Experiments, 144. https://doi.
org/10.3791/59169
Rohman Md. M., Talukder M. Z. A., Hossain M. G., Uddin M. S., Amiruzzaman
M., Biswas A., Ahsan A. F. M. & Chowdhury M. A. Z. (2016). Saline
sensitivity leads to oxidative stress and increases the antioxidants in
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Varapizuela-Sánchez et al. Rev. Fac. Agron. (LUZ). 2022, 39(4): e2239466-6 |
presence of proline and betaine in maize (Zea mays L.) inbred. Plants
Omics Journal, 9(1): 35-47. omics.com/rohman_9_1_2016-35_47.pdf
Sadiq I., Fanucchi F., Paparelli E., Alpi E., Bachi A., Alpi A. & Perata
P. (2011). Proteomic identication of differentially expressed
proteins in the anoxic rice coleoptile. Journal of Plant Physiology,
168:2234-2243. https://doi.org/10.1016/j.jplph.2011.07.009
Servicio de Información Agroalimentaria y Pesquera. SIAP. (2021).
Anuario estadístico de la producción agrícola. Consultado el 9 de mayo
de 2022. https://nube.siap.gob.mx/cierreagricola/
Schneider C., Rasband W. & Eliceiri, K. (2012). NIH Image to ImageJ: 25 years of
image analysis. Nature Methods, 9 (7): 671–675. https://doi.org/10.1038/
nmeth.2089
Turra G. L., Agostini R. B., Fauguel C. M., Presello D. A., Andreo C. S., González
J. M. & Campos-Bermudez V. A. (2015). Structure of the novel monomeric
glyoxalase I from Zea mays. Acta Crystallogr D Biol Crystallogr, 71(10):
2009-2020. https://doi.org/10.1107/S1399004715015205
Zhou Z-H, Wang Y., Ye X-Y & Li Z-G. (2018). Signaling molecule hydrogen
sulde improves seed germination and seedling growth of Maize (Zea
mays L.) under high temperature by inducing antioxidant system and
osmolyte biosynthesis. Frontiers in Plant Science, 9: 1288. https://doi.
org/10.3389/fpls.2018.01288
Varapizuela S. C. F., Sánchez M. M. A. & Pérez S. A. D. (2019). Análisis de
la actividad enzimática de peroxidasas en maíces nativos de Oaxaca
infectados por Aspergillus parasiticus. Revista Ingeniantes, 2(2): 75-79.
https://citt.itsm.edu.mx/ingeniantes/pdfversion/ingeniantes6no2vol2-esp.
pdf