Keywords:

Streptomyces

Nocardiopsis

Antagonism

Solanum lycopersicum

Identication and morphological characterization of marine actinomycetes as biocontrol

agents of Fusarium solani in tomato

Identicación y caracterización morfológica de actinomicetos marinos como agentes de biocontrol

de Fusarium solani en tomate

Identicação e caracterização morfológica de actinomicetos marinhos como agentes de biocontrole

de Fusarium solani em tomate

Juan Antonio Torres-Rodriguez

Juan José Reyes-Pérez

Thelma Castellanos

Carlos Angulo

Evangelina Esmeralda Quiñones-Aguilar

Luis Guillermo Hernandez-Montiel

Rev. Fac. Agron. (LUZ). 2022, 39(1): e223915

ISSN 2477-9407

DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v39.n1.15

Crop Production

Associate editor: Dra. Lilia Urdaneta

Centro de Investigaciones Biológicas del Noroeste, La Paz,

Baja California Sur, México.

Universidad Técnica Estatal de Quevedo, Quevedo, Los

Ríos, Ecuador.

Centro de Investigación y Asistencia en Tecnología y

Diseño del Estado de Jalisco, Guadalajara, México.

Received: 26-02-2021

Accepted: 09-07-2021

Published: 13-02-2022

Abstract

Fusarium spp. damages the roots of crops, its control is with synthetic

fungicides, however, marine actinomycetes can be an option to the use

of agrochemicals. The objective of this work was the identication and

morphological characterization of marine actinomycetes as antagonists to

Fusarium solani (Mart.) Sacc. Fusarium spp. was isolated from diseased

tomato plants and mangrove sediment actinomycetes, both identied through

taxonomic keys and molecular techniques. Eight isolates of Fusarium

spp. were obtained, H8 being the most virulent and it was identied as F.

solani. Thirty actinomycetes were isolated, of which only four inhibited the

phytopathogen, being A19 the one that inhibited the fungus by 70% and was

identied as Streptomyces sp. Marine actinomycetes may be an option for

disease management in plants of agricultural interest.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2022, 39(1): e223915. January - March. ISSN 2477-9407.

2-7 |

Resumen

Fusarium spp. daña a las raíces de los cultivos, su control es con

fungicidas sintéticos, sin embargo, los actinomicetos marinos puede

ser una opción al uso de agroquímicos. El objetivo de este trabajo

fue la identicación y caracterización morfológica de actinomicetos

marinos como antagonistas a Fusarium solani (Mart.) Sacc. Fusarium

spp. fue aislado de plantas enfermas de tomate y los actinomicetos

de sedimento de manglares, ambos se identicaron a través de

claves taxonómicas y por técnicas moleculares. Se obtuvieron ocho

aislamientos de Fusarium spp., siendo H8 el más virulento y fue

identicado como F. solani. Se aislaron 30 actinomicetos, de los

cuales solo cuatro inhibieron al topatógeno, siendo A19 el que

inhibió en un 70% al hongo y fue identicado como Streptomyces sp.

Los actinomicetos marinos pueden ser una opción para el manejo de

enfermedades en plantas de interés agrícola.

Palabras clave: Streptomyces, Nocardiopsis, antagonismo, Solanum

lycopersicum.

Resumo

Fusarium spp. danica as raízes das lavouras, seu controle é feito

com fungicidas sintéticos, no entanto, os actinomicetos marinhos

podem ser uma alternativa ao uso de agroquímicos. O objetivo

deste trabalho foi a identicação e caracterização morfológica de

actinomicetos marinhos como antagonistas a Fusarium solani (Mart.)

Sacc. Fusarium spp. foi isolado a partir de tomateiros doentes e

actinomicetos de sedimento de manguezais, ambos foram identicados

por meio de chaves taxonômicas e técnicas moleculares. Foram

obtidos oito isolados de Fusarium spp., sendo H8 o mais virulento

e identicado como F. solani. Foram isolados 30 actinomicetos,

dos quais apenas quatro inibiram o topatógeno, sendo A19 o que

inibiu o fungo em 70% e foi identicado como Streptomyces sp. Os

actinomicetos marinhos podem ser uma alternativa efetiva para o

manejo de doenças em plantas de interesse agrícola.

Palavras-chave: Streptomyces, Nocardiopsis, antagonismo, Solanum

lycopersicum.

Introduction

Tomato (Solanum lycopersicum L.), is an important crop in many

regions of the world (Reyes-Pérez et al., 2018). This crop is susceptible

to Fusarium spp. (Li et al., 2018), which, causes losses close to 80%

of production (Akbar et al., 2016). The symptoms of plants with

Fusarium spp. are; defolation, wilting and yellowing of leaves, and

stem and root necrosis (Summerell et al., 2003). Fusarium spp. is

controlled by synthetic fungicides such as: Mancozeb, Benomil,

Carbendazim, among others (Gadhave et al., 2020), However, its

application causes resistance to fungi and negative effects on the

environment, human and animal health (Torres-Rodriguez et al.,

2021). The search for alternatives to decrease the use of synthetic

fungicides in agriculture is a priority worldwide (Maluin and Hussein,

2020).

The use ofactinomycetes as biocontrol agents towards

phytopathogens is an alternative to the application of agrochemicals

(Wang et al., 2018). Among the antagonistic mechanisms of

actinomycetes are, antibiotics, siderophores, induction of host

resistance, hydrolytic enzymes, among others (Gopalakrishnan et al.,

2021; Igarashi et al., 2021; Shen et al., 2021). Actinomycetes from

terrestrial environments have been extensively studied, however,

actinomycetes from marine environments are an understudied

resource, which may be more efcient in controlling plant

phytopathogens (Gong et al., 2018). Mangroves are ecosystems that

are found in tropical and subtropical intertidal regions worldwide

(Sangkanu et al., 2017). In these ecosystems, salinity and nutrient

availability are highly variable, resulting in unique characteristics

for the isolation of marine actinomycetes (Soldan et al., 2019). The

objective of this work was the identication and morphological

characterization of marine actinomycetes as biocontrol agents against

Fusarium solani.

Materials and methods

Isolation and morphological identication of Fusarium spp.

Roots of tomato plants with Fusarium symptoms were collected

from a commercial orchard located in El Carrizal, Baja California

Sur, Mexico at 23°47’00” north latitude and 110°17’40” west latitude.

Root pieces of 5 mm were disinfected with 2% sodium hypochlorite

for 30 sec. They were washed with sterile distilled water and dried on

absorbent paper. After, they were sown in Petri dishes with potato-

dextrose-agar (PDA, Difco 39 g.L

-1

) plus streptomycin (0.1 g.L

-1

)

and ampicillin (0.1 g.L

-1

) and were incubated at 28 °C for 6 days in

complete darkness. Colonies were puried in Petri dishes with PDA

and stored in slant tubes at 4 °C. Fungal sporulation was determined

(+++ abundant, ++ good, + moderate) (Sivakumar et al., 2018) and

for macroscopic and microscopic identication the taxonomic keys of

Summerell et al. (2003) were used.

Pathogenicity test

The concentration of each fungus was adjusted to 1.10

conidia.mL

-1

using a Neubaüer chamber. Tomato seedlings var.

Saladet of 25 days, were immersed in conidia suspension of each

isolation for 15 min, prior to transplantation. As a control, plants

were immersed in sterile distilled water. The plants were kept at

28 °C, 80% relative humidity (HR) and 12 h light in a growth

chamber (Convairon

) for 26 days. The severity of the disease was

determined using the Marlatt scale et al. (1996)'; 1=plants

without symptoms; 2=slight chlorosis and wilting; 3=moderate

chlorosis and wilting; 4=severe chlorosis and wilting; 5=dead

plant. In addition, we quantified; height, stem diameter, root fresh

weight and disease incidence (%DI) (Saravanakumar et al., 2016)

using the formula: %DI= (PI/TP)×100%, where Pi=number of

infected plants and TP=total plants. Koch’s postulates were

tested. Five replicates (seedlings) per treatment were performed

and the experiment was repeated twice.

Molecular identication a nd p hylogenetic a nalysis of

Fusarium spp.

The ex

traction of DNA was carried out according to

the methodology of Ochoa et al. (2007). The ITS1-5.8s-

ITS2 region of rDNA was amplied using primers ITS1

(5’ TCCGTAGGTGAACCCTGCGG 3’) and ITS4 (5”

TCCTCCGCTTATTGATATGC 3”) (White et al., 1990). A thermal

cycler (Applied Biosystems®) was used with a denaturation period of

3 min at 95 °C, followed by 30 cycles (denaturation at 95 °C for 1 min,

alignment for 30 s at 50 °C and an extension of 1 min at 72 °C), with

a nal extension at 72 °C for 10 min. PCR products were sequenced

in Genewiz®. Phylogenetic analysis was performed with the MEGA

7 program (Kumar et al., 2018) with the maximum parsimony (MP)

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Torres-Rodriguez et al. Rev. Fac. Agron. (LUZ). 2022, 39(1): e2239153-7 |

method, using the Kimura-2 parameter model (Tamura, 1992) and

Gama distribution and 10,000 replicates (bootstrap). The MP tree was

obtained using NNI (Nearest-Neighbor-Interchange).

Isolation and identication of marine actinomycetes

Sixteen samples of marine mangrove sediment were collected

from four sampling sites in the Zacatecas estuary located in La

Paz, Baja California Sur, Mexico at 24°9’30” north latitude and

110°25’37” west latitude. The collection was performed at a distance

of 0-1, 1-3 and 3-5 m from the shoreline, at a depth of 25 cm.

Sediment samples were collected with a 10 cm diameter soil auger.

The central portion of the samples was extracted with the help of

a sterile spoon. The samples were dried at room temperature for 7

days. One g of sample was weighed and suspended in 9 mL of sterile

seawater, it was incubated for 20 min in water bath at 60 °C and the

solution was serially diluted to 10

-6

(Palla et al., 2018). It was added

1 mL of each dilution to 15 mL of malt extract yeast agar medium

(ISP2; malt extract 10 g, yeast extract 4 g, dextrose 4 g, agar 20 g,

seawater 1 L, pH 7.2). Plates were incubated at 28 °C for 15 days.

Each colony was puried in ISP2 and maintained in 20% glycerol at

-80 °C. Actinomycetes were identied with the keys of Shirling and

Gottlieb (1966) and Gram staining (Duraipandiyan et al., 2010).

In vitro antagonism of marine actinomycetes vs. F. solani

A 0.5 cm disc of each actinomycete grown in ISP2 was placed

in Petri dishes with PDA 1 cm from the edge of the plate and in

the center a 0.5 cm disc of F. solani from a 7-day culturein PDA.

A group of Petri dishes were inoculated with a reference strain of

terrestrial origin cataloged as ED48 of Streptomyces sp. provided

by the Centro de Investigación y Asistencia en Tecnología y Diseño

del Estado de Jalisco, Mexico. Another group was inoculated with

the phytopathogen plus the fungicide Carbendazim (6 mg.mL

-1

) and

another group was inoculated only with F. solani. The plates were

incubated for 10 days at 28 °C. The percentage of radial growth

inhibition (RGPI, %) of the fungus was determined with the formula:

[(R1-R2)/R1]×100% where R1=radial growth of F. solani on the

control plate and R2=growth of F. solani in the direction towards the

actinomycete colony (Azadeh et al., 2010). Five plates per treatment

were used and the experiment was repeated twice.

Antimicrobial activity in actinomycete supernatants

Each actinomycete was cultivated in ISP2 at 30 °C for 7 days.

After, 5 mL of sterile water were added and the spores were scraped

and transferred to a 250 mL Erlenmeyer ask containing 50 mL of

starch casein broth and incubated at 150 rpm and 28 °C for 2 days.

The cells were harvested, washed and re-suspended in 25 mL of sterile

saline solution, subsequently, 10 mL of each inoculum was deposited

in a 250 mL ask containing 100 mL of nutrient broth (millet 10 g.L

-1

glucose 10 g.L

-1

, CaCO

2 g.L

-1

, NaCl 2.5 g.L

-1

, peptone 3 g.L

-1

, pH

7.2-7.4) and incubated at 150 rpm and 28 °C for 12 days. The medium

was centrifuged at 8000 x g. for 20 min at 4 °C, the supernatant was

passed through a 0.22 μm membrane lter and stored at 4 °C. It

was placed 1 mL of the supernatant from each actinomycete on a

sensidisc 1 cm from the edge of the Petri dishes with PDA and a

disk of F. solani was placed in the center. One group of Petri dishes

was inoculated with strain ED48, another group was inoculated with

the phytopathogen plus the fungicide Carbendazim (6 mg.mL-1) and

another group was inoculated only with F. solani. The percentage of

radial growth inhibition (RGPI, %) of the fungus was determined

with the formula: [(R1-R2)/R1]×100% where R1=radial growth of F.

solani on the control plate and R2=growth of F. solani in the direction

towards the actinomycete colony (Azadeh et al., 2010). Five plates per

treatment were used and the experiment was repeated twice.

Molecular identication and phylogenetic analysis of marine

actinomycetes

DNA was extracted using the modied Ochoa method et al. (2007).

PCR amplication of the 16S rRNA gene sequence was performed

using primers 27f (5′-AGAGTTTGATCCTGGCTCAG-3’) and

1492r (5′-GGTTACCTTGTTACGACTT-3’) (Wang et al., 2018). A

thermal cycler (Applied Biosystems®) was used with a denaturation

period of 3 min at 98 °C, followed by 30 cycles (denaturation at 94

°C for 1 min, alignment for 1 min at 52 °C and an extension of 1 min

at 72 °C), with a nal extension at 72 °C for 10 min. PCR products

were sequenced in Genewiz®. Phylogenetic analyses were performed

with the MEGA 7 program (Kumar et al., 2018) by the neighbor-

joining method using the Tamura-3 parameter model (Tamura, 1992)

and Gama distribution and 10,000 repeats (bootstrap).

Statistical analysis

Data were analyzed by one-way analysis of variance method

(ANOVA) using STATISTICA 10.0 software (software StatSoft,

Tulsa, OK) and Fisher’s LSD test was used (P<0.05) for separation

of means.

Results and discussion

Isolation and identication of Fusarium species

Eight isolates were obtained: H1, H2, H3, H4, H5, H6, H7

and H8 of Fusarium spp. that presented different morphological

characteristics, related to color, sporulation and mycelium (table 1).

According to Summerell et al. (2003) variability in morphology is

common among Fusarium species. Choi et al. (2018) report Fusarium

spp. colonies with diverse shapes, textures and colors. Duarte Leal

et al. (2016) observed red, violet, salmon and yellow Fusarium spp.

isolates. Macroconidia showed semi-curved, straight and slender

shapes, with 3 to 5 septa, with a blunt or papillate apical cell type

and foot-shaped basal cell or light notch. Microconidia were reniform

and fusiform in shape (table 2). Differences were found among

macroconidia and chlamydospores formed by the eight isolates,

according to Murugan et al. (2020) and Sivakumar et al. (2018), there

is variability among reproductive structures of Fusarium species.

Pathogenicity of Fusarium spp.

Of the eight Fusarium spp. isolates, only H3, H6, H7 and H8 were

pathogenic, observing 100% incidence in plants (table 3). Control

plants showed the greatest height, stem diameter and root fresh weight

because there is a relationship between Fusarium spp. pathogenicity

with decreased plant growth (Chang et al., 2018). It has been reported

that there is difference in virulence among isolates of Fusarium spp.

(Murugan et al., 2020). In this regard, Nirmaladevi et al. (2016)

observed variation in virulence of Fusarium spp. isolates, 45% were

highly virulent and 30% were moderately virulent. The pathogenicity

of Fusarium spp. is mediated by the action of lytic enzymes

(endopolygalacturonase, exopolygalacturonase, endoxylanase and

endopectate lyase) that depolymerize all cell wall components, such

as cellulose, pectins and proteins (extensins). In addition, these

enzymes serve to inactivate the plant's defense protein components,

such as chitinase and β-1,3-glucanase (Roncero et al., 2000).

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2022, 39(1): e223915. January - March. ISSN 2477-9407.

4-7 |

Table 1. Morphological characteristics of Fusarium spp. isolated from roots of Solanum lycopersicum L., in Baja California Sur, Mexico.

Isolation Color Sporulation Mycelium

H1 Gray + Sparse,white, aerial mycelium

H2 Light yellow + Abundant, white, cottony

aerial mycelium

H3 White to cream ++ Sparse, white, cottony, hyaline,

aerial mycelium

H4 White to cream +++ Dense, white, cottony, hyaline,

aerial mycelium

H5 Light yellow +++ Abundant, white, cottony

aerial mycelium

H6 Pale violet +++ Abundant, white pinkish,

occus, aerial mycelium

H7 Dark violet +++ Abundant, white pinkish,

occus, aerial mycelium

H8 Brown yellow +++ Abundant, white, cottony,

hyaline, aerial mycelium

Table 2. Characteristics of the reproductive structures of Fusarium spp. isolation.

Isolation

Macroconidia Microconidia

chlamydospore

Shape Septum Apical cell

Basal

cell

Shape Septum

H1 Semicurve 3 Blunt Foot shape Reniform 0 Paired, smooth wall

H2 Straight, slender 3-4 Blunt Light notch Reniform 0-1 ------------

H3 Semicurve 3 Blunt Foot shape Reniform 0 ------------

Dorsiventral

curvature

4-5 Narrow Foot shape Reniform 0 Paired, smooth wall

H5 Semicurve 3 Blunt Light notch Reniform 0-1 Simple warty

H6 Dorsiventralcurvature 3-5 Papillate Foot shape

Reniform,

fusiform

0 Paired, smooth wall

H7 Dorsiventral curvature 3-5 Papillate Foot shape

Reniform,

Fusiform

0 Paired, smooth wall

H8 Semicurve 3-5 Blunt Foot shape

Reniform,

fusiform

0-1 Paired, smooth wall

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Torres-Rodriguez et al. Rev. Fac. Agron. (LUZ). 2022, 39(1): e2239155-7 |

Table 3. Severity of Fusarium spp. isolation and their effect on

growth variables in tomato.

Treatment Severity

Height (mm)

Stem

diameter

(mm)

Root fresh

weight (mg)

Control 0 233.6±11.3

4.1±0.3

55.0±4.3

H3 3 166.4±11.1

2.2±0.4

32.4±3.7

H6 4 125.2±,12.4

1.6±0.3

28.4±3.9

H7 4 129.1±11.7

1.6±0.3

27.8±4.1

H8 5 75.4±12.8

1.2±0.4

18.4±3.8

a, b, c, d

Different letters between columns differ signicantly according to Fisher

(P<0.05). Severity*: 1=plants without symptoms; 2=slight chlorosis and wilting;

3=moderate chlorosis and wilting; 4=severe chlorosis and wilting; 5=dead plant.

Molecular identication and phylogenetic analysis of

Fusarium sp.

The size of the PCR product of the ITS1-5.8s-ITS2 region of

isolate H8 was 550 bp. Its sequence was 100% identical to F. solani.

In the phylogenetic analysis, the ITS1-5.8s-ITS2 sequences were

grouped with F. solani as a single group (gure 1). Morphology of

the fungi allows their identication to the genus (Summerell et al.,

2003), however, the similarities in the reproductive structures make

their identication at the species level complex (Al-Fadhal et al.,

2019). Singha et al. (2016) observed differences in morphological

and molecular identication (ITS region) of Fusarium species. The

ITS region is studied for fungal identication due to the species

specicity of this region and provides better resolution at the

subspecies level and therefore, sequence analysis is a superior option

for phylogenetic studies (Okubara et al., 2005). The dendogram

indicated that the sequence obtained in the present study clustered

with other F. solani sequences. The colony morphology and

sequence of the ITS region of isolate H8, identied it as F. solani.

Figure 1. Phylogenetic tree based on the ITS1-5.8s-ITS2 region

of the H8 fungus isolated from tomato plants diseased

by Fusarium spp. Bootstrap values are indicated as

percentages over the nodes in this analysis (10,000

bootstrap).

Isolation and morphological identication of marine

actinomycetes

Thirty isolates of actinomycetes that showed differences in

mycelium, color, texture, shapewere obtained and were determined

as Gram-positive bacteria (table 4). The determination of the

characteristics of actinomycetes is important in the evaluation of

the diversity of the microbial community, these can be differentiated

based on texture, color, shape and elevation of colonies, among

others (Rathore et al., 2019). The morphological results are similar

to those reported by Goudjal et al. (2014), who obtained isolates

with coloration ranging from yellowish white to brownish gray.

Mangrove ecosystems are one of the habitats with a large number of

organisms (Barka et al., 2016; Sangkanu et al., 2017). Only 1% of

the species in these ecosystems have been studied and there is a lack

of knowledge about their ecological role and potential application,

especially in agriculture (Palla et al., 2018; Ameen et al., 2021).

Table 4. Morphological characteristics of marine actinomycetes

isolation.

Isolation Mycelium Mycelium color Texture Colony

A1 Substrate Yellowish gray Wrinkled/coarse Irregular

A2 Substrate Pale yellow Folded Irregular

A3 Substrate Yellowish gray Wrinkled Circular

A4 Aerial Dark yellow Creamy Irregular

A5 Substrate Yellowish gray Wrinkled Irregular

A6 Substrate Light yellow Wrinkled Circular

A7 Substrate Pale yellow Folded Circular

A8 Aerial Pale yellow Creamy Punctiform

A9 Substrate Light yellow Wrinkled Irregular

A10 Substrate Gray Wrinkled Irregular

A11 Substrate Red Creamy Irregular

A12 Substrate Yellow Creamy Irregular

A 13 Substrate Light yellow Creamy Circular

A 14 Substrate Dark brown Wrinkled Irregular

A 15 Substrate Light pink Creamy Circular

A 16 Substrate Light gray Creamy circular

A 17 Aerial Dark gray Creamy Irregular

A 18 Aerial Yellow Creamy Circular

A 19 Substrate Yellow Folded Rhizoid

A 20 Aerial Dark gray Creamy Irregular

A 21 Substrate Light yellow Creamy Punctiform

A 22 Substrate White Creamy Circular

A 23 Aerial Yellow Creamy Punctiform

A 24 Substrate Light pink Creamy Circular

A 25 Aerial Dark yellow Creamy Irregular

A 26 Aerial Dark gray Creamy Irregular

A 27 Substrate Light yellow Wrinkled Circular

A 28 Aerial Yellow Creamy Circular

A 29 Substrate Yellow Creamy Circular

A 30 Substrate Yellow Folded Circular

In vitro antagonism tests of marine actinomycetes against

F. solani

Only four isolates showed antifungal activity (A20, A19, A18

and A15) against F. solani. A19 showed the highest antagonistic

activity with a RGPI (Percentage of radial growth inhibition) of

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2022, 39(1): e223915. January - March. ISSN 2477-9407.

6-7 |

72%, which did not show difference with the synthetic fungicide.

A15 showed the lowest RGPI with 39.53% (gure 2a). Only A19

and A18 showed an effect on supernatant. A19 showed a RGPI of

44.92% and it did not show difference with ED48 (gure 2b).

Figure 2. In vitro antagonism of marine actinomycetes against

F. solani. (a) Percentage of radial growth inhibition

(RGPI) of actinomycetes against F. solani. (b) RGPI of

actinomycetes supernatants against F. solani. Synthetic

fungicide= Carbendazim (6 mg.mL

-1

). n= 5. ± Standard

Desviation. Equal letters in the columns do not differ

signicantly according to Fisher (P<0.05).

Actinomycetes from terrestial environments have been widely

studied as biocontrol agents against phytopathogens (Benhadj et al.,

2019). Therefore, isolation of actinomycetes from under-researched

environments such as marine, glacial, saline, among others, will

provide new biocontrol agents that can be applied in agriculture

(Gong et al., 2018). Several species of Streptomyces have been used

for the control of soil phytopathogens (Ling et al., 2020). Among

the bioactive compounds they produce are: hydrolytic enzymes and

actinomycins, which are antibiotics belonging to the chromopeptide

lactone family that function as growth inhibitors (Chen et al., 2020).

Nocardiopsis species exhibit antifungal activity against Fusarium

species and produce various antimicrobial metabolites (Intra et

al., 2011). The antagonistic activity of actinomycetes against plant

pathogens depends on their ability to produce hydrolytic enzymes,

antifungal metabolites, competition for nutrients, siderophores,

among others (Igarashi et al., 2021; Shen et al., 2021; Vurukonda

et al., 2018).

Molecular identication and phylogenetic analysis of marine

actinomycetes

PCR products of the 16S region were 1500 bp in size. A19 and

A20 were 99.56% similar to Streptomyces sp. and A15 and A18

to Nocardiopsis lucentensis (99.50%). Phylogenetic analysis of the

16S gene of A20 grouped it together with Streptomyces griseoavus

and A19 was grouped in the Streptomyces sp. clade. Phylogenetic

analysis of A18 and A15 grouped them with Nocardiopsis

lucentensis (gure 3).

The 16s rRNA gene is found in prokaryotic organisms and

archaeobacteria and its eukaryotic counterpart exists, its size is

1500 bp and it presents a high degree of conservation to distinguish

between taxa, even at deep taxonomic levels (Clarridge, 2004).

Based on colony morphology and 16s rRNA gene sequence, A20 was

identied as Streptomyces griseoavus, isolate A19 as Streptomyces

sp. and isolates A15 and A18 as Nocardiopsis lucentensis.

Figure 3. Phylogenetic tree based on the 16S rRNA gene of

actinomycetes A20, A19, A18 and A15 isolated from

marine environments. Bootstrap values are given

as percentages over the nodes in this analysis (10,000

bootstrap).

Conclusions

Thirty isolates of marine actinomycetes were obtained, of which

Streptomyces sp., S. griseoavus and Nocardiopsis lucentensis

showed in vitro antifungal activity against F. solani. Streptomyces sp.

showed the highest antifungal activity against the phytopathogenic

fungus with a (RGPI) of 72%. Marine environments are a new

source for isolation of microorganisms that can be used as biocontrol

agents against phytopathogens.

Acknowledgement

J. A. Torres-Rodriguez thanks the Consejo Nacional de Ciencia

y Tecnología-México for Grant 2021910046. J. J. Reyes-Pérez and

L. G. Hernandez-Montiel were thesis co-directors.

Literature cited

Akbar, K., Abbasi, F. M., Sajid, M., Ahmad, M., Khan, Z. U., Aziz-Ud-Din, and

Ali, H. (2016). Marker-assisted selection and pyramiding of I1 and Ph3

genes for multiple disease resistance in tomato through PCR analysis.

International Journal of Biosciences, 9(3), 108-113. http://dx.doi.

org/10.12692/ijb/9.3.108-113

Al-Fadhal, F. A., AL-Abedy, A. N. and Alkhaje, D. A. (2019). Isolation

and molecular identication of Rhizoctonia solani and Fusarium

solani isolated from cucumber (Cucumis sativus L.) and their control

feasibility by Pseudomonas uorescens and Bacillus subtilis. Egyptian

Journal of Biological Pest Control, 29(1), 1-11. https://doi.org/10.1186/

s41938-019-0145-5

Ameen, F., AlNadhari, S. and Al-Homaidan, A. A. (2021). Marine

microorganisms as an untapped source of bioactive compounds.

Saudi Journal of Biological Sciences, 28(1), 224-231. https://doi.

org/10.1016/j.sjbs.2020.09.052

Azadeh, B. F., Sariah, M. and Wong, M. Y. (2010). Characterization of

Burkholderia cepacia genomovar I as a potential biocontrol agent of

Ganoderma boninense in oil palm. African Journal of Biotechnology,

9(24), 3542-3548.

Barka, E. A., Vatsa, P., Sanchez, L., Gaveau-Vaillant, N., Jacquard, C., Klenk, H.

P., Clément, C., Ouhdouch, Y. and van Wezel, G. P. (2016). Taxonomy,

physiology, and natural products of Actinobacteria. Microbiology

and Molecular Biology Reviews: MMBR, 80(1), 1-43. https://doi.

org/10.1128/MMBR.00019-15

Benhadj, M., Gacemi-Kirane, D., Menasria, T., Guebla, K. and Ahmane,

Z. (2019). Screening of rare actinomycetes isolated from natural

wetland ecosystem (Fetzara Lake, northeastern Algeria) for hydrolytic

enzymes and antimicrobial activities. Journal of King Saud University-

Science,31(4), 706-712. https://doi.org/10.1016/j.jksus.2018.03.008

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Torres-Rodriguez et al. Rev. Fac. Agron. (LUZ). 2022, 39(1): e2239157-7 |

Chang, X., Dai, H.,Wang, D., Zhou, H., He, W., Fu, Y., Ibrahim, F., Zhou, Y.,

Gong, G., Shang, J., Yang, J.,Wu, X.,Yong, T., Song, C. and Yang, W.

(2018). Identication of Fusarium species associated with soybean root

rot in Sichuan Province, China.European Journal of Plant Pathology,

151(3), 563-577. https://doi.org/10.1007/s10658-017-1410-7

Chen, Z., Ou, P., Liu, L. and Jin, X. (2020). Anti-MRSA activity of actinomycin

X2 and collismycin a produced by Streptomyces globisporus WA5-

2-37 from the intestinal tract of American cockroach (Periplaneta

americana). Frontiers in Microbiology, 11, 555. https://doi.org/10.3389/

fmicb.2020.00555

Choi, H. W., Hong, S. K., Lee, Y. K., Kim, W. G. and Chun, S. (2018). Taxonomy

of Fusarium fujikuroi species complex associated with bakanae on

rice in Korea. Australasian Plant Pathology, 47(1), 23-34. https://doi.

org/10.1007/s13313-017-0536-6

Clarridge, J. E. (2004). Impact of 16S rRNA gene sequence analysis for

identication of bacteria on clinical microbiology and infectious diseases.

Clinical Microbiology Reviews, 17(4), 840-862. https://doi.org/10.1128/

CMR.17.4.840-862.2004

Duarte Leal, Y., Echevarría Hernández, A. y Martínez Coca, B. (2016).

Identicación y caracterización de aislamientos de Fusarium spp.

presentes en garbanzo (Cicer arietinum L.) en Cuba. Revista de Protección

Vegetal, 31(3), 173-183. https://cutt.ly/qnva8A5

Duraipandiyan, V., Sasi, A. H., Islam, V. I. H.,Valanarasu, M. and Ignacimuthu,

S. (2010). Antimicrobial properties of actinomycetes from the soil of

Himalaya. Journal de Mycologie Medicale, 20(1), 15-20. https://doi.

org/10.1016/j.mycmed.2009.11.002

Gadhave, A. D., Patil, P. D., Dawale, M. B., Suryawnshi, A. P., Joshi, M. S.

and Giri, V. V. (2020). In-vitro Evaluation of different fungicides and

bioagents against Fusarium oxysporum f. sp. lycopersici. International

Journal of Current Microbiology and Applied Sciences, 9(8), 3576-3584.

https://doi.org/10.20546/ijcmas.2020.908.412

Gong, B., Chen, S., Lan, W., Huang, Y. and Zhu, X. (2018). Antibacterial and

antitumor potential of actinomycetes isolated from mangrove soil

in the Maowei Sea of the southern coast of China. Iranian Journal of

Pharmaceutical Research, 17(4), 1339-1346. https://doi.org/10.22037/

ijpr.2018.2280

Gopalakrishnan, S., Srinivas, V., Naresh, N., Pratyusha, S., Ankati, S.,

Madhuprakash, J., Govindaraj, M. and Sharma, R. (2021). Deciphering

the antagonistic effect of Streptomyces spp. and host-plant resistance

induction against charcoal rot of sorghum. Planta, 253(2), 1-12. https://

doi.org/10.1007/s00425-021-03577-5

Goudjal, Y., Toumatia, O.,Yekkour, A., Sabaou, N., Mathieu, F. and Zitouni, A.

(2014). Biocontrol of Rhizoctonia solani damping-off and promotion of

tomato plant growth by endophytic actinomycetes isolated from native

plants of Algerian Sahara. Microbiological Research, 169(1), 59-65.

https://doi.org/10.1016/j.micres.2013.06.014

Igarashi, M., Sawa, R., Umekita, M., Hatano, M., Arisaka, R., Hayashi, C.,

Ishizaki, Y., Suzuki, M. and Kato, C. (2021). Sealutomicins, new enediyne

antibiotics from the deep-sea actinomycete Nonomuraea sp. MM565M-

173N2. Journal of Antibiotics, 74,291-299. https://doi.org/10.1038/

s41429-020-00402-1

Intra, B., Mungsuntisuk, I., Nihira, T., Igarashi,Y. and Panbangred, W. (2011).

Identifcation of actinomycetes from plant rhizospheric soils with inhibitory

activity against Colletotrichum spp., the causative agent of anthracnose

disease. BMC Research Notes,4, 98. https://doi.org/10.1186/1756-0500-

4-98

Kumar, S., Stecher, G., Li, M., Knyaz, C. and Tamura, K. (2018). MEGA X:

Molecular evolutionary genetics analysis across computing platforms.

Molecular Biology and Evolution, 35(6), 1547-1549. https://doi.

org/10.1093/molbev/msy096

Li, Y. T., Hwang, S. G., Huang, Y. M. and Huang, C. H. (2018). Effects of

Trichoderma asperellum on nutrient uptake and Fusarium wilt of

tomato. Crop Protection, 110, 275-282. https://doi.org/10.1016/j.

cropro.2017.03.021

Ling, L., Han, X., Li, X., Zhang, X.,Wang, H., Zhang, L., Cao, P., Wu, Y., Wang,

X., Zhao, J. and Xiang, W. (2020). A Streptomyces sp. NEAU-HV9:

Isolation, identication, and potential as a biocontrol agent against

Ralstonia solanacearum of tomato plants. Microorganisms, 8(3), 351.

https://doi.org/10.3390/microorganisms8030351

Maluin, F. N. and Hussein, M. Z. (2020). Chitosan-based agronanochemicals as a

sustainable alternative in crop protection. Molecules, 25(7), 1611. https://

doi.org/10.3390/molecules25071611

Marlatt, M. L., Correll, J. C., Kaufmann, P. and Cooper, P. E. (1996). Two

genetically distinct populations of Fusarium oxysporum f. sp. lycopersici

race 3 in the United States. Plant Disease, 80(12), 1336-1342. https://doi.

org/10.1094/PD-80-1336

Murugan, L., Krishnan, N.,Venkataravanappa, V., Saha, S., Mishra, A. K.,

Sharma, B. K. and Rai, A. B. (2020). Molecular characterization and race

identication of Fusarium oxysporum f. sp. lycopersici infecting tomato

in India. 3 Biotech, 10, 486. https://doi.org/10.1007/s13205-020-02475-z

Nirmaladevi, D., Venkataramana, M., Srivastava, R. K., Uppalapati, S. R.,

Gupta, V. K., Yli-Mattila, T., Tsui, K. M., Srinivas, C., Niranjana, S.

R. and Chandra, N. S. (2016). Molecular phylogeny, pathogenicity and

toxigenicity of Fusarium oxysporum f. sp. lycopersici. Scientic Reports,

6(1), 1-14. https://doi.org/10.1038/srep21367

Ochoa, J. L., Hernández-Montiel, L. G., Latisnere-Barragán, H., León de La Luz,

J. L. and Larralde-Corona, C. P. (2007). Isolation and identication of

pathogenic fungi from orange Citrus sinensis L. Osbeck cultured in Baja

California Sur, México. Ciencia y Tecnología Alimentaria, 5(5), 352-359.

https://doi.org/10.1080/11358120709487712

Okubara, P. A., Schroeder, K. L. and Paulitz, T. C. (2005). Real-time polymerase

chain reaction: applications to studies on soilborne pathogens.

Canadian Journal of Plant Pathology, 27(3), 300-313. https://doi.

org/10.1080/07060660509507229

Palla, M. S., Guntuku, G. S., Muthyala, M. K. K., Pingali, S. and Sahu, P. K.

(2018). Isolation and molecular characterization of antifungal metabolite

producing actinomycete from mangrove soil. Beni-Suef University

Journal of Basic and Applied Sciences, 7(2), 250-256. https://doi.

org/10.1016/j.bjbas.2018.02.006

Rathore, D. S., Sheikh, M., Gohel, S. and Singh, S. P. (2019). Isolation strategies,

abundance and characteristics of the marine actinomycetes of Kachhighadi,

Gujarat, India. Journal of the Marine Biological Association of India,

61(1), 71-78. http://dx.doi.org/10.6024/jmbai.2019.61.1.2028-11

Reyes-Pérez, J. J., Luna-Murillo, R. A., Reyes-Bermeo, M. R.,Vázquez-Morán,

V. F., Zambrano-Burgos, D. y Torres-Rodríguez, J. A. (2018). Efecto de

los abonos orgánicos sobre la respuesta productiva del tomate (Solanum

lycopersicum L). Revista de la Facultad de Agronomía de la Universidad

del Zulia, 35(1), 26-39. https://cutt.ly/bnvsmtW

Roncero, M. I., Di Pietro, A., Ruiz-Roldán, M. C., Huertas-González, M. D.,

Garcia-Maceira, F. I., Méglecz, E., Jiménez, A., Caracuel, Z., Sancho-

Zapatero, R., Hera, C., Gómez-Gómez, E., Ruiz-Rubio, M., González-

Verdejo, C. I. and Páez, M. J. (2000). Role of cell wall-degrading enzymes

in pathogenicity of Fusarium oxysporum. Revista Iberoamericana de

Micología, 17(1), S47-53.

Sangkanu, S., Rukachaisirikul, V., Suriyachadkun, C. and Phongpaichit, S.

(2017). Evaluation of antibacterial potential of mangrove sediment-

derived actinomycetes. Microbial Pathogenesis,1 12, 303-312. https://

doi.org/10.1016/j.micpath.2017.10.010

Saravanakumar, K., Yu, C., Dou, K., Wang, M., Li,Y. and Chen, J. (2016).

Synergistic effect of Trichoderma-derived antifungal metabolites and

cell wall degrading enzymes on enhanced biocontrol of Fusarium

oxysporum f. sp. cucumerinum. Biological Control, 94, 37-46. https://doi.

org/10.1016/j.biocontrol.2015.12.001

Shen, T., Lei, Y., Pu, X., Zhang, S. and Du, Y. (2021). Identication and application

of Streptomyces microavus G33 in compost to suppress tomato bacterial

wilt disease.Applied Soil Ecology, 157, 103724. https://doi.org/10.1016/j.

apsoil.2020.103724

Shirling, E. B. and Gottlieb, D. (1966). Methods for characterization of

Streptomyces species. International Journal of Systematic and Evolutionary

Microbiology, 16(3), 313-340. https://doi.org/10.1099/00207713-16-3-

313

Singha, I. M., Kakoty, Y., Unni, B. G., Das, J. and Kalita, M. C. (2016).

Identication and characterization of Fusarium sp. using ITS and RAPD

causing fusarium wilt of tomato isolated from Assam, North East India.

Journal of Genetic Engineering and Biotechnology, 14(1), 99-105.

https://doi.org/10.1016/j.jgeb.2016.07.001

Sivakumar, T., Balabaskar,P. and Sanjeevkumar, K. (2018). Variability in Fusarium

oxysporum f. sp. lycopersici causing wilt of tomato. International Journal

of Chemical Studies, 6(2), 3655-3659. https://cutt.ly/bnvsBL6

Soldan, R., Mapelli, F., Crotti, E., Schnell, S., Daffonchio, D., Marasco, R., Fusi,

M., Borin, S. and Cardinale, M. (2019). Bacterial endophytes of mangrove

propagules elicit early establishment of the natural host and promote

growth of cereal crops under salt stress. Microbiological Research, 223,

33-43. https://doi.org/10.1016/j.micres.2019.03.008

Summerell, B. A., Salleh, B. and Leslie, J. F. (2003). A utilitarian approach to

Fusarium identication. Plant Disease, 87(2), 117-128. https://doi.

org/10.1094/PDIS.2003.87.2.117

Tamura, K. 1992. Estimation of the number of nucleotide substitutions when

there are strong transition-transversion and G+C-content biases.

Molecular Biology and Evolution, 9(4), 678-687. https://doi.org/10.1093/

oxfordjournals.molbev.a040752

Torres-Rodriguez, J. A., Reyes-Pérez, J. J.,Castellanos, T., Angulo, C., Quiñones-

Aguilar, E. E. and Hernandez-Montiel, L. G. (2021). A biopolymer

with antimicrobial properties and plant resistance inducer against

phytopathogens: Chitosan. Notulae Botanicae Horti Agrobotanici Cluj-

Napoca, 49(1), 1-15. https://doi.org/10.15835/nbha49112231

Vurukonda, S. S. K. P., Giovanardi, D. and Stefani, E. (2018). Plant growth

promoting and biocontrol activity of Streptomyces spp. as endophytes.

In International Journal of Molecular Sciences, 19(4), 952. https://doi.

org/10.3390/ijms19040952

Wang, X., Zhang, M.,Gao, J., Pu, T., Bilal, M.,Wang,Y. and Zhang, X. (2018).

Antifungal activity screening of soil actinobacteria isolated from

Inner Mongolia, China. Biological Control, 127, 78-84. https://doi.

org/10.1016/j.biocontrol.2018.07.007

White, T. J., Bruns, T., Lee, S. and Taylor, J. W. (1990). Amplication and direct

sequencing of fungal ribosomal RNA genes for phylogenetics. Innis,

M.A., D.H. Gelfand, J. J. Sninsky and T.J. White (Ed.), PCR protocols:

a guide to methods and applications, (Vol. 18, pp. 315-322). Academic

Press,1990. Inc. New York. http://dx.doi.org/10.1016/B978-0-12-372180-

8.50042-1