360
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v38.n2.08 ISSN 2477-9407
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Recibido el 23-08-2019 . Aceptado el 26-10-2020.
*Autor de correspondencia. Correo electrónico:
lgonzalezpaz@gmail.com
Characterization of CRISPR genetic sequences
in microorganisms associated with infections in
shrimp (Litopenaeus vannamei)
Caracterización de secuencias genéticas CRISPR en
microorganismos asociados a infecciones en camarón
(Litopenaeus vannamei)
Caracterização de sequências genéticas CRISPR em
microrganismos associados a infecções em camarões
(Litopenaeus vannamei)
Ángel Parra
1
, Carla Lossada
4
, Aleivi Pérez
3
, Johnny
Navarrete
5
and Lenin González
1,2*
Departamento de Biología, Facultad Experimental de Ciencias. La Universidad del
Zulia.
1
Laboratorio de Genética y Biología Molecular. Email: (AP) angelparra115@
gmail.com, ; Email: (LG) lgonzalezpaz@gmail.com, .
2
Laboratorio de Citogenética.
3
Laboratorio de Microbiología General. Email: aleiviciencias@gmail.com, .
4
Laboratorio
de Caracterización Molecular y Biomolecular – Centro de Investigación y Tecnología de
los Materiales Instituto Venezolano de Investigación Cientíca - Zulia. Sección 526.
Maracaibo, Venezuela. Email: lossadacarla@gmail.com, .
5
Escuela Superior Politécnica
Agropecuaria de Manabí Manuel Félix López, Sitio El Limón, Campus Politécnico
Calceta, Manabí, Ecuador. Email: jnava_57@hotmail.com, .
Abstract
In shrimp farming, the family of proteobacteria Vibrionaceae, especially
the species of the genus Vibrio, represent one of the main responsible for
infections in shrimp production (Litopenaeus vannamei), generating great
losses to this industry. Phagotherapy emerges as a novel alternative for the
control of said infections in substitution to the use of antibiotics, thanks to the
specic inhibitory activity of these viruses. However, it is necessary to take
into account the presence in prokaryotes of genetic sequences called clusters
of regularly interspaced short palindromic repeats (CRISPR) that act as an
immune system against invasion of external mobile genetic elements such
361
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
as phage or plasmids. Due to its characteristics, the CRISPR/Cas system is
used as a tool for gene editing. This study presents the comparative analysis
of 7 CRISPR loci found in 5 sequences of complete genomes, available
in the database of NCBI/GenBank, to determine the potential use of the
phage strategy in shrimp farming. The CRISPR systems corresponded to
types I-E, I-F and III-D. 53 % of the spacers (75/142) presented homology
with plasmids, while the remaining 47 % (67/142) showed homology with
bacteriophages, mostly non-typical Vibrio infective viruses. The use of phage
therapy is proposed as a treatment for infections caused by members of the
family Vibrionaceae in shrimp cultures, due to the low occurrence of CRISPR
systems in the species studied and the low immunity to their phages, thus
ensuring greater sensitivity.
Keywords: CRISPR-Cas systems, Vibrio, phagotherapy, bioinformatic
analysis.
Resumen
En el cultivo del camarón, la familia de las proteobacterias Vibrionaceae,
especialmente las especies del género Vibrio, representan uno de los principales
responsables de las infecciones en la producción de camarones (Litopenaeus
vannamei), generando grandes pérdidas a esta industria. La fagoterapia
surge como una alternativa novedosa para el control de dichas infecciones en
sustitución al uso de antibióticos, gracias a la actividad inhibitoria especica
de estos virus. Sin embargo, es necesario tomar en cuenta la presencia en
procariotas de secuencias genéticas denominadas repeticiones palindrómicas
cortas agrupadas y regularmente interespaciadas (CRISPR) que actúan como
sistema inmune contra la invasión de elementos genéticos móviles externos
como fagos o plásmidos. Dadas sus características, el sistema CRISPR/Cas
se emplea como herramienta para la edición de genes. En este estudio se
presenta el análisis comparativo de 7 loci CRISPR encontrados en 5 secuencias
de genomas completos, disponibles en la base de datos del NCBI/GenBank,
para determinar la potencialidad del empleo de la estrategia fágica en
camaronicultura. Los sistemas CRISPR correspondieron a los tipos I-E, I-F y
III-D. El 53 % de los espaciadores (75/142) presentó homología con plásmidos,
mientras que el 47 % restante (67/142) mostró homología con bacteriófagos,
en su mayoría virus no típicos infectivos de Vibrio. Se propone el uso de la
fagoterapia como tratamiento de infecciones causadas por miembros de la
familia Vibrionaceae en cultivos de camarón debido a la baja ocurrencia de
sistemas CRISPR en las especies estudiadas y la baja inmunidad a sus fagos,
asegurando así una mayor sensibilidad.
Palabras clave: sistemas CRISPR-Cas, Vibrio, fagoterapia, análisis
bioinformático.
362
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
Introducción
En el cultivo de camarón
(Litopenaeus vannamei), la familia
de proteobacterias Vibrionaceae, el
género Vibrio, representa uno de
los principales responsables de las
infecciones con alta inuencia en
la producción larvaria asociadas al
cultivo de camarón. Estas bacterias
Gram-negativas son ubicuas y
están ampliamente distribuidas en
ambientes acuáticos, desde agua
salobre hasta aguas profundas, en
asociación con animales marinos,
algas y detritos. Los Vibrios también
Resumo
Na criação de camarões, a família das proteobacteria Vibrionaceae,
especialmente as espécies agrupadas no género Vibrio, representam uma das
principais responsáveis por infecções na produção de camarão (Litopenaeus
vannamei), gerando grandes prejuízos a esta indústria. A terapia fágica surge
como uma nova alternativa para o controle dessas infecções em substituição
ao uso de antibióticos, graças à atividade inibitória especíca desses vírus.
No entanto, é necessário levar em consideração a presença em procariotos de
sequências genéticas denominadas repetições palindrômicas curtas agrupadas
e regularmente espaçadas (CRISPR) que atuam como um sistema imunológico
contra a invasão de elementos genéticos móveis externos, como fagos ou
plasmídeos. Pelas suas características, o sistema CRISPR / Cas é utilizado como
ferramenta de edição de genes. Este estudo apresenta a análise comparativa de
7 locos CRISPR encontrados em 5 sequências de genomas completos, disponíveis
no banco de dados do NCBI/GenBank, para determinar o potencial de utilização
da estratégia de fagos na carcinicultura. Os sistemas CRISPR corresponderam
aos tipos I-E, I-F e III-D. 53 % dos espaçadores (75/142) mostraram homologia
com plasmídeos, enquanto os restantes 47 % (67/142) mostraram homologia com
bacteriófagos, principalmente vírus infecciosos Vibrio não típicos. A utilização da
terapia fágica é proposta como tratamento para infecções causadas por membros
da família Vibrionaceae em cultivo de camarão devido à baixa ocorrência de
sistemas CRISPR nas espécies estudadas e à baixa imunidade aos seus fagos,
garantindo assim maior sensibilidade.
Palavras chave: sistemas CRISPR-Cas, Vibrio, fagoterapia, análise
bioinformática.
Introduction
In shrimp culture, the family of
proteobacteria Vibrionaceae, those
of the genus Vibrio, represent one of
the main responsible for the infections
with a high inuence on larval
production associated with shrimp
culture (Litopenaeus vannamei).
These Gram-negative bacteria are
ubiquitous and widely distributed
in aquatic environments, from
brackish water to deep sea water,
in association with marine animals,
algae and detritus. Vibrios are also
present in estuarine and marine
363
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
aquatic ecosystems where shrimp are
naturally found and/or cultivated.
Bacteria of this genus are considered
part of the normal microbiota of
shrimp, constituting the highest
percentage of all bacteria isolated
from the digestive tract, gills, cuticle
and occasionally in the hemolymph.
However, under conditions of stress
or imbalance in the natural bacterial
microbiota these bacteria can induce
the development of infections in
organisms such as vibriosis (or
bacterial shrimp septicemia) (Cheng et
al., 2008; Aguirre et al., 2010; Yooseph
et al., 2010).
Of the genus Vibrio, the main
virulent strains of shrimp identied
in various larval stages are V.
alginolyticus, V. anguillarum, V.
parahaemolyticus, V. harveyi and
V. vulnicus (Kalatzis et al., 2018),
generating high mortalities, economic
losses in the production; they also cause
public health problems in humans due
to the consumption of derived marine
products contaminated with these
opportunistic pathogens (Cheng et al.,
2008; Won and Park, 2008; Aguirre et
al., 2010; Alagappan et al., 2010). The
prevention and control of diseases in
shrimp farming is based primarily
on the use of antibiotics (Lomelí
and Martínez, 2014), however, the
growing emergence of bacterial strains
resistant to antibiotics, added to the
concern induced by the prospect of
not having effective antibiotics in the
near future, has prompted the search
for new antagonistic alternatives
toward those that have not yet
developed mechanisms of resistance,
with fewer side effects, and with high
están presentes en ecosistemas
acuáticos estuarinos y marinos donde
los camarones se encuentran y/o
cultivan naturalmente. Las bacterias
de este género se consideran parte de
la microbiota normal del camarón,
constituyendo el porcentaje más alto
de todas las bacterias aisladas del
tracto digestivo, branquias, cutículas
y ocasionalmente en la hemolinfa.
Sin embargo, en condiciones de estrés
o desequilibrio en la microbiota
bacteriana natural, estas bacterias
pueden inducir el desarrollo de
infecciones en organismos como la
vibriosis (o septicemia bacteriana del
camarón) (Cheng et al., 2008; Aguirre
et al., 2010; Yooseph et al., 2010).
Del género Vibrio, las principales
cepas virulentas de camarón
identicadas en varios estadios
larvales son V. alginolyticus, V.
anguillarum, V. parahaemolyticus, V.
harveyi y V. vulnicus (Kalatzis et al.,
2018), generando altas mortalidades,
pérdidas económicas en la producción;
también causan problemas de
salud pública en humanos debido
al consumo de productos marinos
derivados contaminados con estos
patógenos oportunistas (Cheng
et al., 2008; Won y Park, 2008;
Aguirre et al., 2010; Alagappan et
al., 2010). La prevención y control de
enfermedades en la camaronicultura
se basa principalmente en el uso de
antibióticos (Lomelí y Martínez, 2014),
sin embargo, la creciente aparición de
cepas bacterianas resistentes a los
antibióticos, sumado a la preocupación
inducida por la perspectiva de no
contar con antibióticos efectivos. en
un futuro próximo, ha impulsado la
364
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
specicity, to avoid the disturbance
of the intestinal microbiota of the
human being and guarantee a greater
effectiveness of the treatments (Rice
and Stokes, 2008).
One of the promising strategies
on the way to the objective of nding
more effective, less toxic and specic
antagonists to control microorganisms
that cause infections, is represented
by the viruses that exclusively infect
the bacteria, called bacteriophages,
and their enzymatic derivatives
(enzybiotics). These are inhibitory
agents that have been described as
potential antimicrobial agents with
therapeutic interest (São, 2018),
including their application in shrimp
farming (Oliveira et al., 2012; Kalatzis
et al., 2018).
Although it is not clear if there
is any mechanism of bacterial
resistance against enzybiotics
(phage lysins), studies on the
use of phages as an alternative
treatment or biological control
show the opposite, and currently
a large number of investigations
are carried out in group of genomic
sequences present in several
prokaryotic microorganisms
known as “Clustered Regularly
Interspaced Short Palindromic
Repeats” (CRISPR), which have
shown a distinctive characteristic
of most genomes of bacteria and
archaea, that endows resistance
against bacteriophages (Horvath
and Barrangou, 2010; Kalatzis et
al., 2018).
In addition to the fact that
research on the presence of
CRISPRs has focused mainly on
búsqueda de nuevas alternativas
antagónicas hacia aquellas que aún
no han desarrollado mecanismos
de resistencia, con menores efectos
secundarios, y con alta especicidad,
para evitar la alteración de la
microbiota intestinal del ser humano
y garantizar una mayor efectividad de
los tratamientos (Rice y Stokes, 2008).
Una de las estrategias
prometedoras en el camino hacia el
objetivo de encontrar antagonistas más
ecaces, menos tóxicos y especícos
para el control de los microorganismos
causantes de infecciones, está
representada por los virus que infectan
exclusivamente a las bacterias,
llamados bacteriófagos, y sus
derivados enzimáticos (enzibióticos).
Se trata de agentes inhibidores que
han sido descritos como potenciales
agentes antimicrobianos con interés
terapéutico (São, 2018), incluida su
aplicación en el cultivo de camarón
(Oliveira et al., 2012; Kalatzis et al.,
2018).
Aunque no está claro si existe algún
mecanismo de resistencia bacteriana
frente a enzibióticos (fago lisinas), los
estudios sobre el uso de fagos como
tratamiento alternativo o control
biológico muestran lo contrario, y
actualmente se realizan un gran
número de investigaciones en grupo
de secuencias genómicas presentes en
varios microorganismos procarióticos
conocidos como “Repeticiones
palindrómicas cortas agrupadas
regularmente interespaciadas”
(CRISPR), que han mostrado una
distintiva característica en la mayoría
de los genomas de bacterias y arqueas,
que coneren resistencia contra
365
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
bacteria of clinical interest, while
little is known about the dynamics of
CRISPR in organisms of commercial
importance (Lyons et al., 2015),
the objective of this study, was to
perform a comparative analysis of
CRISPR Systems in genomes of
microorganisms with pathogenic
inuence on shrimp Litopenaeus
vannamei.
Materials and methods
Genomic sequences and
identication of CRISPR
structures
Five species of Vibrio were
studied: Vibrio alginolyticus, V.
anguillarum, V. parahaemolyticus,
V. harveyi, V. vulnicus and the
species Photobacterium damselae, all
associated with systemic infections
in shrimp, such as vibriosis, of
which a total of 1104 genomes were
obtained according to the database
of the NCBI (National Center for
Biotechnology Information, http://
www.ncbi.nlm.nih.gov/, Benson et
al., 2008). Draft genome sequences
were obtained from specic web
sites that are compiled in the Entrez
Genome project list (http://www.ncbi.
nlm.nih.gov/genomes/lproks.cgi) or
in the Genomes OnLine Database
(http://www.genomesonline.org/)
(Bernal et al., 2001), 69 of the
sequences correspond to complete
genomic sequences including 14 V.
alginolyticus, 13 V. anguillarum, 21
V. parahaemolyticus, 4 V. harveyi,
15 V. vulnicus, as well as 2
complete chromosomal sequences of
Photobacterium damselae (Table 1).
bacteriófagos (Horvath y Barrangou,
2010; Kalatzis et al., 2018).
Además de que la investigación
sobre la presencia de CRISPRs se ha
centrado principalmente en bacterias
de interés clínico, mientras que se
conoce poco sobre la dinámica de
CRISPR en organismos de importancia
comercial (Lyons et al., 2015), el
objetivo de este estudio, consistió
en realizar un análisis comparativo
de Sistemas CRISPR en genomas
de microorganismos con inuencia
patógena en camarón Litopenaeus
vannamei.
Materiales y métodos
Secuencias genómicas e
identicación de estructuras
CRISPR
Se estudiaron cinco especies
de Vibrio: Vibrio alginolyticus, V.
anguillarum, V. parahaemolyticus,
V. harveyi, V. vulnicus y la especie
Photobacterium damselae, todas
asociadas a infecciones sistémicas
en camarones, como la vibriosis, de
las cuales un total de 1104 genomas
se obtuvieron de acuerdo con la base
de datos del NCBI (Centro Nacional
de Información Biotecnológica, http://
www.ncbi.nlm.nih.gov/, Benson et al.,
2008). Las secuencias preliminares
del genoma se obtuvieron de sitios web
especícos que se compilan en la lista de
proyectos Entrez Genome (http://www.
ncbi.nlm.nih.gov/genomes/lproks.
cgi) o en la base de datos Genomes
OnLine (http://www.genomesonline.
org/) (Bernal et al., 2001), 69 de las
secuencias corresponden a secuencias
genómicas completas, que incluyen 14
366
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
CRISPR loci
Species
Accession num-
ber GenBank
Length of
CRISPR (pb)
Start End
Spacer
number
Length of
Spacer (pb)
DR
number
Length of
DR (pb)
DR Consensus
CRISPR
Type
Cas
gene
Ref.
Vp.
FORC_022
CP013248.1 /
P013249.1
1707 826587 828294 28 32 29 28 GTTAACTGCCACACAGGCAGCTTAGAAA I-F 6
Vh. ATCC
43516
CP014038.2 /
P014039.2
2287 73377 75664 37 32-33 38 29 GTGTTCTCCGTACCCACGGAGATGAACCG I-E 8
Vv. YJ016
BA000037.2 /
A000038.2
661 1694586 1695247 9 33-37 10 35
GTTTCAGACATGCCCGGTTTAGACGG-
GATTAAGAC
III-D 7
Chen et
al., 2003
Vv. 93U204
CP009261.1 /
P009262.1
3328 511712 515040 55 32 56 28 GTTCACTGCCGTATAGGCAGCTTAGAAA I-F 6
Lo et al.,
2014
256 2123187 2123443 3 43 4 32
GATATTTCTAACTGGGATACTTCCAAT-
GTAAA
Pd. KC-
Na-1*
CP021151.1 /
P021152.1
447 246163 246610 7 32 8 28 CTTCACTGCCGAGTAGGCAGCTTAGAAA I-F 6
29 257070 257278 3 31 4 29 CTTCACTGCCGAGTAGGCAGCTTAGAAAT
Vp. FORC_022, Vh. ATCC 43516, Vv. YJ016 y 93U204, Pd. KC-Na-1, are the abbreviations of V. parahaemolyticus FORC_022, V. harveyi ATCC 43516,
V. vulnicus YJ016 y 93U204, and P. damselae KC-Na-1, respectively; *, before classied in V. damselae; CRISPR, Clustered Regularly Interspaced Short
Palindromic Repeats; DR, direct repeats; Cas, CRISPR-associated (cas) gene cluster.
Vp. FORC_022, Vh. ATCC 43516, Vv. YJ016 y 93U204, Pd. KC-Na-1, son las abreviaturas de V. parahaemolyticus FORC_022, V. harveyi ATCC 43516, V.
vulnicus YJ016 y 93U204, y P. damselae KC-Na-1, respectivamente; *, antes clasicado en V. damselae; CRISPR, repeticiones palindrómicas cortas agrupadas
regularmente interespaciadas; DR, repeticiones directas; Cas, grupo de genes asociados a CRISPR (cas).
Table 1. CRISPR/Cas systems in Vibrionaceae genomes.
Cuadro 1. Sistemas CRISPR / Cas en genomas de Vibrionaceae.
367
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
For published genome sequences,
C
RISPR loci were obtained from the
CRISPRdb database (Grissa et al.,
2007a). Alternatively, the CRISPR
loci in the genomes were identied
by CRISPRFinder (Grissa et al.,
2007b). For this, two search criteria
were followed. One of them was the
screening of possible CRISPR locations
by detecting maximum repetitions
(repetition with the maximum possible
extension to the right or left without
incurring a mismatch) by using the
VMatch package, which is the REPuter
update (Kurtz and Schleiermacher,
1999) based on an efcient
implementation of improved sufx
arrays (Abouelhoda, 2004). The default
parameters used were the following: a
repetition length of 23 to 55 bp, a gap
size between repetitions of 25 to 60 bp,
a 20% mismatch of nucleotides between
repetitions. The other search criterion
was based on the CRISPR function
determination, for which lters are
added to help validate a CRISPR, such
as the search for non-identical spacers
with a size that should be from 0,6*
to 2,5* the size of the repetition. This
lter is congured to eliminate tandem
repeats. The comparison of the spacers
was made by aligning them (using
the default parameters of the Muscle
program). The percentage of similarity
of the spacers is calculated with the
percentage_identity function of the
(Bio)perl interface (AlignIO methods,
Muscle interface), a parameter set to
60 %.
To discriminate between conrmed
CRISPR structures from those
questionable, small structures similar
to CRISPR, that is, having only two
V. alginolyticus, 13 V. anguillarum,
21 V. parahaemolyticus, 4 V.
harveyi, 15 V. vulnicus, así como 2
secuencias cromosómicas completas
de Photobacterium damselae (Cuadro
1).
Las secuencias genómicas públicas
de los loci CRISPR se obtuvieron de
la base de datos CRISPRdb (Grissa
et al., 2007a). Alternativamente, los
loci CRISPR en los genomas fueron
identicados por CRISPRFinder
(Grissa et al., 2007b). Para ello se
siguieron dos criterios de búsqueda.
Uno de ellos fue el cribado de posibles
ubicaciones de CRISPR mediante la
detección de repeticiones máximas
(repetición con la máxima extensión
posible a la derecha o izquierda sin
incurrir en un desajuste) mediante
el uso del paquete VMatch, que es la
actualización de REPuter (Kurtz y
Schleiermacher, 1999) basada en una
implementación eciente de arreglos de
sujos mejorados (Abouelhoda, 2004).
Los parámetros predeterminados
utilizados fueron los siguientes: una
longitud de repetición de 23 a 55 pb, un
tamaño de espacio entre repeticiones
de 25 a 60 pb, un 20% de desajuste
de nucleótidos entre repeticiones. El
otro criterio de búsqueda se basó en la
determinación de la función CRISPR,
para lo cual se agregan ltros para
ayudar a validar un CRISPR, como la
búsqueda de espaciadores no idénticos
con un tamaño que debe ser de 0,6
* a 2,5 * el tamaño de la repetición.
Este ltro está congurado para
eliminar repeticiones en tándem.
La comparación de los espaciadores
se realizó alineándolos (utilizando
los parámetros predeterminados del
368
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
or three repeated sequences or direct
repeats (DR), are classied using a
level of Evidence, rated from 1 to 4,
where 1 includes small CRISPR (with
3 or fewer spacers) and 2 to 4 are
classied based on the repetition and
similarity of the spacer. This is because
questionable CRISPR structures
often tend to be byproducts of the
CRISPRFinder identication that are
not true CRISPR. Further, the tests
to verify the internal preservation
of the candidate repetitions and
the divergence of the candidate
spacers offered by CRISPRFinder are
considered.
Bioinformatic analysis and
statistical results
For the search of genes cas, the
rst step consisted in the identication
of open reading frames (ORF) with
Prodigal (Hyatt, 2010). Then these ORFs
were analyzed by the MacSyFinder
program by the models for the search of
HMM genes (Hidden Markov Models) in
a library of known Cas proteins (Abby,
2014). BLAST was used to identify the cas
genes in the upstream and downstream
sequences of the CRISPR and TIGRFAM
loci (Horvath et al., 2009). The cas type
and subtype were found through the
analysis of cas conglomerates, thanks
to the CRISPRCas-Finder program
(Grissa et al., 2007b). The unique spacer
sequences as well as their origin were
identied by NCBI’s multiple sequence
alignment program with predetermined
arguments. All spacers were compared
with the GenBank database to nd
homologous sequences with matches
of ≥85% (minimum of 28/33 coincident
nucleotides) (Horvath et al., 2009; Shen
et al., 2017).
programa Muscle). El porcentaje de
similitud de los espaciadores se calcula
con la función percent_identity de la
interfaz (Bio) perl (métodos AlignIO,
interfaz Muscle), un parámetro
establecido en 60%.
Para discriminar entre estructuras
CRISPR conrmadas de aquellas
cuestionables, las estructuras
pequeñas similares a CRISPR, es
decir, que tienen solo dos o tres
secuencias repetidas o repeticiones
directas (DR), se clasican utilizando
un nivel de evidencia, calicado de 1 a
4, donde 1 incluye pequeños CRISPR
(con 3 o menos espaciadores) y 2 a 4 se
clasican en función de la repetición
y similitud del espaciador. Esto se
debe a que las estructuras CRISPR
cuestionables a menudo tienden a ser
subproductos de la identicación de
CRISPRFinder que no son CRISPR
verdadero. Además, se consideran las
pruebas para vericar la preservación
interna de las repeticiones
candidatas y la divergencia de los
espaciadores candidatos ofrecidos por
CRISPRFinder.
Análisis bioinformático y
resultados estadísticos
Para la búsqueda de genes
cas, el primer paso consistió en
la identicación de marcos de
lectura abiertos (ORF) con Prodigal
(Hyatt, 2010). Luego, estos ORF
fueron analizados por el programa
MacSyFinder mediante los modelos
para la búsqueda de genes HMM
(Hidden Markov Models) en una
biblioteca de proteínas Cas conocidas
(Abby, 2014). BLAST se usó para
identicar los genes cas en las
secuencias aguas arriba y aguas
369
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
Phylogenetic trees were generated
based on the unweighted pair group
method (UPGMA) for the core protein
Cas, specically Cas1 using the
MUSCLE algorithm (Tamura et al.,
2013). In parallel, multiple sequence
alignments and phylogenetic analyzes
were performed using Clustal X, and
dendograms were visualized with the
accompanying application NJ Plot
(Larkin et al., 2007). The distance
matrix was calculated using the
Jaccard coefcient. The structure of
Cas proteins was evaluated by multiple
sequence alignments with Geneious
global alignment (Needleman-Wunsch)
with predetermined arguments (Shen
et al., 2017). The PubMLST database
was used for the determination of
the multilocus sequences and the
sequence typing data were used for the
goeBURST analysis (Shen et al., 2017).
The one-factor analysis of variance
(ANOVA) was used as a statistical
model to establish differences between
the comparative parameters analyzed.
Results and discussion
The present study aims to offer
an analysis of CRISPR/Cas gene
sequences in microorganisms of high
inuence in aquaculture production
associated with shrimp infections,
specically in the species of commercial
interest L. vannamei, intending to
offer alternatives for the control of
pathogens of bacterial origin, through
phagotherapy, a promising technology
for shrimp farming based on the
management of specic lytic phages
of bacteria or their lytic enzymes
(enzybiotics).
abajo de los loci CRISPR y TIGRFAM
(Horvath et al., 2009). El tipo y
subtipo cas se encontraron mediante
el análisis de conglomerados cas,
gracias al programa CRISPRCas-
Finder (Grissa et al., 2007b). Las
secuencias espaciadoras únicas, así
como su origen, fueron identicadas
por el programa de alineación de
secuencias múltiples del NCBI con
argumentos predeterminados. Todos
los espaciadores se compararon
con la base de datos GenBank para
encontrar secuencias homólogas
con coincidencias de ≥85% (mínimo
de 28/33 nucleótidos coincidentes)
(Horvath et al., 2009; Shen et al.,
2017).
Los árboles logenéticos se
generaron con base en el método
de grupos de pares no ponderados
(UPGMA) para la proteína central
Cas, especícamente Cas1, utilizando
el algoritmo MUSCLE (Tamura et
al., 2013). En paralelo, se realizaron
múltiples alineamientos de secuencia
y análisis logenéticos utilizando
Clustal X, y los dendogramas se
visualizaron con la aplicación adjunta
NJ Plot (Larkin et al., 2007). La matriz
de distancias se calculó mediante el
coeciente de Jaccard. La estructura
de las proteínas Cas se evaluó
mediante múltiples alineamientos
de secuencia con alineamiento global
Geneious (Needleman-Wunsch) con
argumentos predeterminados (Shen et
al., 2017). La base de datos PubMLST
se utilizó para la determinación de las
secuencias multilocus y los datos de
tipicación de secuencias se utilizaron
para el análisis goeBURST (Shen et
al., 2017). El análisis de varianza de